Molecular Human Reproduction, Vol. 8, No. 4, 375-384,
April 2002
© 2002 European Society of Human Reproduction and Embryology
Implantation and pregnancy |
Hormonal and embryonic regulation of chemokines IL-8, MCP-1 and RANTES in the human endometrium during the window of implantation
1 Fundación Instituto Valenciano de Infertilidad para el Estudio de la Reproducción Humana (FIVIER) 2 Dpto. de Pediatría, Obstetricia y Ginecología, Facultad de Medicina 3 Dpto. de Bioquímica y Biología Molecular, Facultad de Farmacia, Universidad de Valencia, España
| Abstract |
|---|
|
|
|---|
Chemokines are a family of small polypeptides which specialize in the attraction of leukocytes. The presence of specific leukocyte subsets at the implantation site is an important element of the complex, and not completely understood, process of embryonic implantation. This report includes the investigation of the in-vivo immunolocalization and hormonal regulation of interleukin (IL)-8, monocyte chemotactic protein (MCP)-1 and RANTES (regulated upon activation normal T-cell expressed and secreted) in the human endometrium during hormone replacement therapy cycles for oocyte recipients in an IVF programme. In addition, we have analysed the embryonic regulation of these endometrial epithelial chemokines (IL-8 and MCP-1) using an in-vitro model for the apposition phase of human implantation by co-culturing single human embryos until the blastocyst stage with human endometrial epithelial cells (EEC). IL-8 and MCP-1 were immunolocalized in the human endometrium to the glandular and lumenal epithelium as well as to the endothelial cells. RANTES was mainly localized to the stromal compartment and endothelial cells. The immunoreactive levels of endometrial IL-8 and MCP-1 were up-regulated by the administration of progesterone during the receptive phase of the cycle. Furthermore, it was demonstrated that, in vitro, the human blastocyst does not produce measurable amounts of IL-8, MCP-1 or RANTES; however, it does up-regulate EEC IL-8 mRNA expression (P < 0.05) and protein production (P < 0.05), but not IL-8 secretion. The human embryo did not regulate EEC MCP-1 expression. These results provide evidence of hormonal and embryonic regulation of specific endometrial chemokines, suggesting two different but related mechanisms to induce the production of chemokines by the EEC, thus contributing to the attraction of specific leukocyte populations during the peri-implantation phase.
chemokines/embryonic implantation/endometrium/human blastocyst
| Introduction |
|---|
|
|
|---|
Chemokines (short for chemoattractant cytokines) are a newly identified family of small polypeptides (7080 amino acids) specialized in the attraction of specific leukocyte subsets. In reproductive biology, these molecules and related cells have been implicated in ovulation, menstruation, parturition and embryo implantation as well as in pathological processes such as preterm delivery, endometriosis, ovarian hyperstimulation syndrome and HIV infection (Simón et al., 1998
Traditionally, chemokines are classified into two groups, the
or CXC chemokines and the ß or CC chemokines, according to the position of the first two of the four consecutive cysteine residues. Interleukin (IL)-8, an
-chemokine, is a potent chemoattractant and activator of neutrophils (Mukaida et al., 1989
) and T-lymphocytes (Larsen et al., 1989
). IL-8 is produced by a variety of cells types, including monocytes, fibroblasts, lymphocytes and epithelial and endothelial cells (Baggiolini and Dahinden, 1994
). In the human reproductive tract, IL-8 has been detected in the cervix (Barclay et al., 1993
), placenta (Saito et al., 1994
), chorio-decidua (Dudley et al., 1993
) and endometrium (Arici et al., 1993
). Although monocyte chemoattractant protein (MCP)-1 belongs to the ß-chemokine subfamily, it is a closely related protein and a potent chemoattractant and activator of monocytes, macrophages, T-cells, basophils, mast cells and natural killer cells. MCP-1 is secreted by a number of cell types such as endothelial cells (Sica et al., 1990
), fibroblasts (Yoshimura and Leonard, 1990
), monocytes and lymphocytes (Yoshimura and Leonard, 1990
). It has been detected in normal endometrium (Arici et al., 1995
) and endometriotic cells (Akoum et al., 1996
). The ß-chemokine, RANTES (regulated upon activation normal T-cell expressed and secreted), is a chemoattractant for monocytes, eosinophils and basophils, and has been localized to eutopic endometrium and ectopic endometriotic implants (Hornung et al., 1997
).
During the peri-implantation period in the absence of embryo, there is an accumulation of specific leukocyte subsets in the endometrial stroma due to migration from blood vessels and neighbouring tissues (Bulmer and Johnson, 1991). During implantation, when the human blastocyst is present, this specific leukocyte infiltration pattern into the endometrium continues (Bulmer et al., 1985). The existence of a cyclical pattern of specific leukocytes during the implantation window is suggestive of steroid control, but the fact that they do not possess either estrogen or progesterone receptors (King et al., 1996
) suggests that this regulation may be exerted indirectly (Del Pozo et al., 1997
). Therefore, the molecular mechanisms implicated in the attraction of specific leukocyte subsets during the peri-implantation period remain unknown.
A specific molecular cross-talk between the embryo and endometrium has been reported during the human implantation process (Glasser et al., 1991
; De los Santos et al., 1996). The endometrial epithelium is an important element where the molecular interactions between the embryo and the endometrium seem to be initiated (Simón et al., 1997
, 1999
; Galán et al., 2000
; Meseguer et al., 2001
), and where chemokines are produced and received.
In this investigation, we have studied the immunolocalization of endometrial chemokines (IL-8, MCP-1 and RANTES) in an in-vivo model for uterine receptivity. Furthermore, the embryonic regulation of chemokines (IL-8 and MCP-1) produced by endometrial epithelial cells (EEC) was assessed using an in-vitro model for the apposition phase of human implantation.
| Materials and methods |
|---|
|
|
|---|
Institutional approval and informed consent
This study was approved by the institutional review board on the use of human subjects in research at the Instituto Valenciano de Infertilidad (IVI) and complies with the Spanish Law of Assisted Reproductive Technologies (35/88). All patients participating in this study signed a written statement of consent and received information about the study.
Experimental design
To study the immunolocalization of endometrial chemokines (IL-8, MCP-1 and RANTES), endometrial samples from hormone replacement therapy (HRT) cycles of oocyte recipients were obtained during non-receptive, pre-receptive and receptive phases.
The embryonic regulation of EEC IL-8 and MCP-1, in an in-vitro model for apposition, was investigated at the mRNA level (by Northern blot analysis) and at the levels of protein production (by flow cytometry and immunohistochemistry) and protein secretion (by ELISA).
Serum and endometrial samples obtained in from HRT cycles
Patients undergoing oocyte donation as embryo recipients (aged 2339 years) received HRT in a mock cycle prior to the cycle of treatment (Remohí et al., 1995
). Briefly, patients were desensitized for ovarian function with leuprolide acetate (1 mg/day) starting at the secretory phase of the previous menstrual cycle. In addition, estradiol (E2) valerate (Progynova; Schering, Madrid, Spain) 2 mg/day was started on day 1 of the next cycle and continued until day 8, and then increased to 4 mg/day from days 911, and to 6 mg/day from days 1222. Natural micronized progesterone (Progefik; Effik Lab., Madrid, Spain) at 800 mg/day was administered vaginally from days 1622.
According to the period of clinical receptivity, endometrial biopsies (B) and serum samples (S) were obtained in three different phases: non-receptive (S1, B1; day 13), pre-receptive (S2, B2; day 18) and receptive (S3, B3; day 21).
E2 was measured in the serum samples using an immunoenzymatic assay (MEIA, Imx; Abbot Scientific, Madrid, Spain). The inter- and intra-assay coefficient of variations (CVs) for E2 at 0.827 nmol/l were 6.7 and 6.3% respectively. Progesterone was measured by radioimmunoassay (Biomerieux, Charbonnieres Les Bains, France). The CVs for progesterone at 0.699 nmol/l were 9 and 10% respectively.
Endometrial biopsies were fractioned and a portion was weighed, frozen in liquid nitrogen and stored at 70°C until used for molecular biology. Other portions of the endometrial biopsies were dated by histology according to the criteria of Noyes et al. (Noyes et al., 1950
).
Immunohistochemistry
Formalin-fixed and paraffin-embedded endometrial biopsies were sectioned and mounted on glass slides coated with Vectabond TM (Vector Lab, Burlingame, CA, USA). Twelve serial sections (6 µm) from each sample were prepared and the first and last sections were stained with haematoxylineosin. After deparaffinization and rehydration, sections were rinsed three times with phosphate-buffered saline (PBS) for 5 min. Non-specific binding was blocked with non-fat milk (50 mg/ml in PBS). Then, sections were rinsed three times with PBS/0.05% Tween 20 (PBS-T), pH 7.4 and incubated for 1.5 h at 37°C with the following specific antibodies: mouse anti-human IL-8 (Genzyme Diagnostics, Cambridge, MA, USA), mouse anti-human MCP-1 and mouse anti-human RANTES (Pharmigen, San Diego, CA, USA), each at 10 µg/ml. After rinsing four times with PBS-T, sections were incubated for 1.5 h at 37°C with the secondary antibody, fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG whole molecule (Sigma, St Louis, MO, USA). Sections were then washed four times with PBS-T and gently rinsed with distilled water. Sections were mounted in aqueous mounting medium (Dako, Barcelona, Spain) and immunolocalization of chemokines was visualized and photographed using an Olympus 35 mm camera attached to a fluorescence microscope (Nikon, Japan). Immunostaining intensity was evaluated in at least three different specimens obtained from four different patients and interpreted as absent (0), weak (+), moderate (++) or intense (+++) by two independent observers in a blinded fashion.
Endometrial separation, culture and embryo co-culture
Endometrial biopsies were minced into small pieces (<1 mm) and digested with a mild collagenase solution (0.1%) at 37°C for 1 h. Endometrial epithelium was isolated and purified as previously described (Simón et al., 1993
). EEC were cultured to confluence in a steroid-depleted medium (Simón et al., 1994
) containing a 3:1 mixture of Dulbecco's modified Eagle's medium, MCDB-105 and 5 µg insulin (all Sigma), supplemented with 10% charcoal-dextran-treated fetal bovine serum (Hyclone, Logan, UT, USA). The homogeneity of EEC cultures was assessed by morphological characteristics (scanning electron microscopy) (Simón et al., 1999
) and using specific antibodies for the immunocytochemical staining of cytokeratin (an epithelial cell marker) (Simón et al., 1994
). EEC cultures showed <1% contamination with endometrial stromal cells (vimetin-positive) and macrophages (CD68 antigen-positive) (Simón et al., 1994
). After confluence, the culture media was replaced by a 1:1 mixture of IVF:S2 medium (Scandinavian IVF Science AB, Gothenburg, Sweden). Forty-eight hours after insemination of oocytes, each 2- to 4-cell human embryo was transferred to an EEC monolayer. When embryos reached the 8-cell stage, the medium was replaced by a S2 medium (Scandinavian IVF) up to the blastocyst stage. Embryonic development was checked daily and media was changed every 24 h. On day 6 of co-culture, blastocysts were transferred to the recipient using a Frydman catheter. EEC that had been cultured alone under the same conditions were used as controls. Conditioned media from cultures of EEC without embryos, EEC with blastocysts and EEC with arrested embryos were collected each day from days 36 (transfer day) and stored at 20°C until chemokine determinations were performed.
RNA isolation, oligonucleotide probe synthesis and Northern blot analysis
Total RNA was isolated from endometrial tissue samples and from EEC cultures by a modification of the guanidinium isothiocyanate method (Chomczynski et al., 1987) using RNAzol according to the manufacturer's instructions (Tel-Test Inc., Friendswood, Texas, USA). RNA concentrations were determined by optical density (Shimadzu 1201 Spectophotometer, Japan). The A260/A280 ratio for each RNA sample was always between 1.6 and 1.8.
For Northern blot analysis, specific oligonucleotide probes for IL-8, MCP-1 and RANTES were synthesized. The sequence of IL-8 oligonucleotide probe (TGTTGGCGGCGCAGTGTGGTCCACTCTCAATCA) corresponds to a portion of exon 2 of the IL-8 gene (Matsushima et al., 1988
). The sequence of MCP-1 oligonucleotide probe (TTGGGTTTGCTTGTCCAGGTGGTCCATGGA) was complementary to nucleotides 256285 of the coding region of human MCP-1 cDNA (Yoshimura et al., 1989
). The RANTES probe was an oligonucleotide (GCTCATCTCGAAAGAGTTGATGTACTCCCGAACTTTCTTCTTCTCTGGGTT) synthesized based on the reported sequence of the coding region for human RANTES (Oppenheim et al., 1991
). Probes were end-labelled with [32P] ATP (Arici et al., 1993
, 1995
; Manni et al., 1996
).
To normalize the amount of total RNA transferred to the blot, we used a cDNA probe for 28s rRNA, kindly provided by Dr I.L.González, Hahnemen University, PA, USA. Plasmid was amplified and isolated, and the 1.6 kb insert in vector pGEMz (2.7 kb) (Promega Corporation, Madison, WI, USA) was removed using EcoRI/BamHI double digestion and radiolabelled with [32P] ATP with a random primer DNA labelling kit (Roche, Barcelona, Spain).
For Northern blot analysis, total RNA samples (1015 µg) were electrophoresed on a 1% agarose/formaldehyde denaturing gel for 2 h at 76V in 3N-morpholino-propanesulfonic acid buffer (Sambrook et al., 1989
). The integrity of the RNA was analysed by ethidium bromide staining. Samples with evidence of RNA degradation were excluded from subsequent analysis. RNA was transferred onto positively charged nylon membrane (Roche) by capillary action in a 10x concentrated standard saline citrate (SSC) buffer. Finally, RNA was cross-linked to the membrane by UV treatment.
For IL-8 and MCP-1 oligonucleotides and 28S RNA probes, the blots were pre-hybridized overnight at 65°C in a buffer containing 6xSSC, 5xDenhardt's solution, 0.1% sodium dodecyl sulphate (SDS) and 200 ml of salmon sperm DNA (Sigma) according to Sambrook et al. (Sambrook et al., 1989
). Hybridization was performed overnight at 65°C in the same buffer with 5x106 cpm of radiolabelled probes. For RANTES pre-hybridization and hybridization, a solution containing 50% formamide, 5xDenhardt's solution, 0.2 % (w/v) SDS, 50 nmol/l sodium phosphate buffer, pH 7.4, 5 mg/ml dextran sulphate and 200 mg/ml salmon sperm DNA was used. Blots were pre-hybridized overnight at 42°C and hybridized in the same conditions with the radiolabelled RANTES oligonucleotide probe. After hybridization all blots were washed twice with 6xSSC/0.1% SDS for 15 mins at room temperature and with 2xSSC/0.1% SDS for 15 min at 65°C. Autoradiography was performed at 80°C using Kodak X-Omat AR films. Blots were then stripped for 10 min at 95°C in 0.1% SDS prior to being reprobed. Bands from at least four blots for each chemokine were analysed by laser densitometry (Tecnología para Diagnóstico e Investigación, Madrid, Spain) and normalized using the 28S rRNA band for each sample analysed.
Flow cytometry
Intracellular detection of chemokines in EEC cultures was performed by flow cytometry based on previously developed procedures (Jung et al., 1993
; Prussin and Metcalfe, 1995
; Simón et al., 1997
). Cultured EEC were detached with a cell scraper, retrieved, centrifuged and blocked with 1% bovine serum albumin in PBS for 2 h at 4°C. The cell pellet was resuspended in 70% ethanol at 20°C for 20 min and centrifuged. After washing with PBS-T, cells were incubated overnight at 4°C with IL-8 (Genzyme) and MCP-1 (Pharmigen) mouse anti-human antibodies (10 µg/ml). EEC suspensions were washed with PBS-T and mixed with FITC-conjugated anti-mouse IgG whole molecule (Sigma) diluted 1:64 for 150 min at 4°C. Cell suspensions were fixed with 1% paraformaldehyde for 1 h at 4°C. Negative controls were performed in each experiment by omitting the primary antibody. Cells were suspended in PBS and analysed in an Epics Elite flow cytometer (Coulter Cytometry, Hialeah, FL, USA) using an argon ion laser tuned at 488 nm and 15 mW. Debris was excluded by analysis of scatter properties. At least 10 000 events per sample were stored in list-mode files. Data were expressed as the percentage of fluorescent cells (%FC) and as intensity of luminosity in fluorescence arbitrary units (FAU). Variability in the intensity of the fluorescent signal was obtained with full peak of CV.
Determination of chemokine secretion
IL-8 and MCP-1 concentrations were measured on days 3 and 6 of embryo development in the 24 h conditioned media from EEC cultures and co-cultures with blastocysts and arrested embryos (n = 14 per group for IL-8 and n = 12 per group for MCP-1) by ELISA (R&D Systems, Minneapolis, MN, USA). According to the manufacturer's information, the sensitivity of IL-8 and MCP-1 ELISAs were 10 and 5 pg/ml respectively. Intra- and inter-assay CVs were respectively 6.5 and 6% for IL-8, and 5.9 and 4.9% for MCP-1.
The stage of human embryo development during the culture period was also determined (day 3: 810 cells; day 4: morula stage; day 5: blastocyst; n = 10 each). In addition, we investigated the secretion of chemokines to the culture medium by blastocysts or arrested embryos alone (without EEC).
We also studied the influence of E2 and progesterone on chemokine secretion by EEC cultures. The experimental design for E2 and progesterone effects was set by comparing two culture media: S2 medium (Scandinavian IVF) supplemented with E2(0.2 nmol/l) and progesterone (10 nmol/l) and M3 medium (Medicult, Copenhagen, Denmark) without hormones.
Statistical analysis
Data of chemokine concentrations (from ELISA), %FC, intensity of luminosity (FAU; from flow cytometry) and densitometric units (from Northern blot analysis) were expressed as means ± SEM. Statistical analysis was performed using the Statistical Package for the Social Science (SPSS Inc., Chicago, IL, USA). The analysis of variance (ANOVA) for multiple comparisons was carried out among groups and P < 0.05 was considered to be statistically significant.
| Results |
|---|
|
|
|---|
Immunolocalization and hormonal regulation of IL-8, MCP-1 and RANTES in human endometrium.
Peripheral E2 and progesterone levels were determined at the same time as endometrial biopsies were taken (non-receptive, pre-receptive and receptive phases) and were consistent with the expected physiological hormonal levels. On day 13 (non-receptive phase) E2 levels were 333.2 ± 92.9 pg/ml and progesterone was undetectable. On day 18 (pre-receptive phase) E2 and progesterone levels were 331.6 ± 39.1 pg/ml and 9.5 ± 3.8 ng/ml respectively. On day 21 (receptive phase) E2 and progesterone levels were 362.6 ± 78.5 pg/ml and 10.5 ± 6.1 ng/ml respectively. These hormonal levels effectively stimulated endometrial differentiation, as assessed by Noyes histological criteria (Noyes et al., 1950
Endometrial samples showed a specific immunoreactive staining for IL-8, MCP-1 and RANTES (Figure 1
). On day 13, when patients were treated with E2 valerate only, IL-8 and MCP-1 staining was localized at the lumenal and glandular epithelium and perivascular endothelial cells (Figure 1, panels C1, F1
). During the pre-receptive and receptive periods, on days 18 and 21, an increase in staining intensity at the same localizations was observed (Figure 1, panels D1, E1, G1, H1
; Table I
). RANTES was immunolocalized mainly at the stromal compartment and perivascular cells. Significant variation in staining intensity for RANTES on different days was not observed (Figure 1, panels I1, J1, K1
; Table I
). We attempted to study the pattern of mRNA expression of these chemokines in the whole endometrium, but the corresponding band for IL-8 and MCP-1 was not detected (Figure 2
) due to the small contribution of the epithelial fraction to the complete endometrial sample. A band of 1.25 kb corresponding to RANTES was detected in total RNA from endometrial biopsies (Figure 3
).
|
|
|
|
Embryonic regulation of chemokines at the mRNA level in cultured EEC
Northern blot analysis to detect IL-8 mRNA with the control 28S hybridization signal was performed with total RNA from EEC cultured without embryos, with arrested embryos or with blastocysts and from endometrial biopsies. Although IL-8 mRNA was not detected in any of the whole endometrial biopsies at any phase studied, a band of 1.8 kb corresponding to IL-8 mRNA expression was detected in the total RNA from EEC. Quantitative densitometric analysis showed an up-regulation of IL-8 mRNA in EEC co-cultured with human embryos compared with EEC without embryos (P < 0.05). Data were expressed as mean ± SEM from four patients in each group (Figure 2
Likewise, MCP-1 mRNA was not detected by Northern blot analysis in whole endometrial samples, but MCP-1 mRNA (a band of 0.7 kb) was detected in RNA prepared from EEC cultures. However, EEC MCP-1 mRNA did not show any changes in expression in the presence or absence of human blastocysts (Figure 2
).
Unlike the previous chemokines, a band of 1.2 kb corresponding to RANTES was detected in total RNA from endometrial biopsies, and no evidence of RANTES mRNA expression in EEC was detected (Figure 3
). Since RANTES mRNA was not detected in EEC cultures we did not follow-up the study of this molecule in EEC at the protein level.
Embryonic regulation of IL-8 and MCP-1 protein produced by EEC
To quantify the intracellular expression of IL-8 and MCP-1 in cultured EEC, flow cytometry was performed on EEC using the present in-vitro model for apposition, and the results were expressed as the percentage of stained cells (SC) and FAU (Figure 4
).
|
IL-8 expression was significantly up-regulated in EEC in the presence of blastocysts (28.6 ± 5.2% SC; 1.63 ± 0.14 FAU) compared with the control EEC (without embryos) (15.9 ± 3.6% SC; 0.77 ± 0.06 FAU; P < 0.05; Figure 4
Embryonic regulation of IL-8 and MCP-1 protein secreted by EEC
To confirm that the chemokines investigated originated exclusively from EEC, the conditioned media from blastocysts and arrested embryos cultured without EEC were analysed. In the conditioned media from human embryos, no measurable level of IL-8, MCP-1 or RANTES was discovered, confirming that these chemokines originate from EEC cultures.
To investigate the effect of E2 and progesterone on the secretion of EEC chemokines, two different culture media were used: S2 (Scandinavian IVF) supplemented with E2 (0.2 nmol/l) plus progesterone (10 nmol/l) and M3 (Medicult) without hormones. No statistical differences in chemokine secretion were found in EEC without blastocysts, EEC with blastocysts or EEC with arrested embryos, with or without E2 and progesterone.
EEC secreted IL-8 and MCP-1 at the ng/ml range. EEC IL-8 secretion was investigated on days 3 and 6 of embryonic development. On day 3, EEC that had been cultured alone secreted more IL-8 than EEC that had been co-cultured with normal developed or arrested embryos (EEC 45.5 ± 2.7 ng/ml; EECblastocyst 30.5 ± 1.7 ng/ml; EECarrested embryo 31.3 ± 1.4 ng/ml; P < 0.05; Figure 5A
). However, on day 6 no differences were observed (EEC: 28.3 ± 2.3 ng/ml; EECblastocyst: 29.9 ± 1.8 ng/ml; EECarrested embryos: 26.3 ± 2.3 ng/ml; Figure 5A
).
|
MCP-1 secretion by EEC exhibited a similar pattern to IL-8. On day 3, EEC that had been cultured alone secreted more MCP-1 than EEC that had been co-cultured with normal developed or arrested embryos (EEC: 41 ± 3.9 ng/ml; EECnormal developed embryos: 30.8 ± 4.6 ng/ml; EECarrested embryos: 34.7 ± 0.5 ng/ml; P < 0.05). However, on day 6 of culture, no differences were observed in MCP-1 secretion between different EEC groups (EEC: 29.6 ± 3.3 ng/ml; EECblastocyst: 23.4 ± 1.8 ng/ml; EECarrested embryos: 25.7 ± 3.3 ng/ml).
In order to study the influence of embryonic quality on IL-8 secretion patterns, the conditioned media of EEC in contact with developing embryos (n = 10) was analysed each day (days 36). Groups were divided according to the stage of embryonic development on each day. Results showed that, within the same day, those embryos with a normal development (day 3, 8- to 10-cell embryos; day 4, morula; day 5, early blastocyst) induce higher IL-8 secretion in EEC cultures compared with those embryos with retarded development or controls without embryos (Figure 5B
). This effect was evident on days 35 of embryo development and disappeared on day 6 (Figure 5B
).
| Discussion |
|---|
|
|
|---|
The development of the uterine receptive stage is regulated by ovarian steroids and involves a multistep process, which includes plasma membrane transformation of the endometrial epithelium, changes in the cytoskeleton, decidualization of the stromal compartment and a specific recruitment of leukocyte subsets within the stroma. During implantation, leukocyte infiltration occurs in the decidua in humans, comprising of mainly large granular lymphocytes or natural killer cells and also macrophages and T-cells (Bulmer et al., 1991
Our study is focused on the expression and production of endometrial chemokines during the implantation window. For this purpose, we first studied the immunolocalization of chemokines IL-8, MCP-1 and RANTES in the human endometrium. Our findings confirmed previous reports on the endometrial expression of these chemokines (Arici et al., 1993
, 1995
; Critchley et al., 1994
; Jones et al., 1997
). Immunohistochemical experiments showed a different localization pattern: IL-8 and MCP-1 were mainly expressed in glandular and lumenal epithelium and endothelial cells, whereas RANTES staining was localized mainly in the stromal and endothelial cells. Northern blot analysis was not sensitive enough to detect IL-8 and MCP-1 mRNA bands from total endometrial RNA. However, these chemokine mRNAs were detected in total RNA from EEC cultures. Since endometrial stromal cells are the principal constituents of endometrial tissue, RANTES mRNA was detected in the entire endometrial RNA extract, and was absent in EEC cultures.
The hormonal regulation of these chemokines during this period was semi-quantitatively assessed at the immunoreactive protein level in an in-vivo model of hormonal regulation (Meseguer et al., 2001
). After previous estradiol stimulus, progesterone up-regulated the immunoreactive presence of IL-8 and MCP-1 in endometrial epithelium in the pre-receptive (day 18) and receptive (day 21) periods of the secretory phase of the menstrual cycle. This data is consistent with previous findings in natural menstrual cycles (Jones et al., 1997
; Arici et al., 1998
; Milne et al., 1999
). However, using an in-vivo model of progesterone withdrawal and maintenance, an elevation of IL-8 mRNA after progesterone withdrawal has been documented (Critchley et al., 1999
). These findings suggest the implication of these chemokines in endometrial receptivity by progesterone presence and in the premenstrual migration of leukocytes into the endometrium regulated by progesterone withdrawal.
The second significant information presented in this report concerns the embryonic production and regulation of these EEC chemokines. Neither IL-8, MCP-1 nor RANTES are secreted by the human embryo. However, this report uniquely demonstrates that the human blastocyst up-regulates EEC mRNA expression and peptide production of IL-8. This finding strongly suggests that the human embryo provides an important contribution to the endometrial chemokine network at the time of embryo implantation. Therefore, we hypothesized the existence of two separate EEC chemokine inducing `programmes', one regulated by maternal hormones and one by the human embryo.
Another important point to be noted is that the hormonal induction of EEC IL-8 and MCP-1 production was not under direct steroid control in our in-vitro model. This finding indicates that steroid regulation of EEC IL-8 and MCP-1 protein in vivo might be through an indirect mechanism which involves stromal cells or other endometrial cells (King et al., 1996
). However, the embryonic regulation of EEC IL-8 was exerted through a direct mechanism, which involves soluble embryonic factors and their receptors, located in EEC. Nevertheless, the results of the embryonic regulation of endometrial chemokines should be interpreted within the limitations of an in-vitro model.
Paracrine regulation of endometrial epithelial cells by embryonic cytokines, i.e. LIF, HB-EGF and IL-1, has been implicated in the implantation process (Simón et al., 1996
). Embryonic cytokines may be involved in the release of endometrial chemokines, which in turn may induce leukocyte attraction and the activation of endometrial adhesion molecules (Del Pozo et al., 1997
; Simón et al., 1997
; García-Velasco and Arici, 1999a,b) during the adhesion phase of human implantation.
Further investigations are needed to assess the precise mechanism by which chemokines and leukocyte subsets participate in the acquisition of the endometrial receptive state within a spatial and temporally defined period of maximal uterine receptivity. The identification of signalling pathways and target cells responsible for this stage will provide important data to improve our understanding of the implantation process for fertility or contraceptive purposes.
| Acknowledgements |
|---|
|
|
|---|
The authors would like to thank Professor J.E.O'Connor, Facultad de Medicina, Universidad de Valencia, Spain, for his expert technical assistance, continued interest and support. We are also very grateful to Professor A.Arici, School of Medicine, Yale University, USA, for his contribution to the IL-8 and MCP-1 molecular biology experiments. This work was supported in part by Spanish Government Grant FISS 00/0643.
| Notes |
|---|
4 To whom correspondence should be addressed at: C/ Guardia Civil 23, 46020 Valencia, Spain. E-mail: csimon{at}interbook.net
| References |
|---|
|
|
|---|
Akoum, A., Lemay, A., McColl, S., Turcot-Lemay, L. and Maheux, R. (1996) Elevated concentration and biologic activity of monocyte chemotactic protein-1 in the fluid of patients with endometriosis. Fertil. Steril., 66, 1723.[Web of Science][Medline]
Arici, A., Head, J.R., MacDonald, P.C. and Casey, M.L. (1993) Regulation of interleukin-8 gene expression in human endometrial cells in culture. Mol. Cell. Endocrinol., 94, 195204.[Web of Science][Medline]
Arici, A., McDonald, P.C. and Casey, M.L. (1995) Regulation of monocyte chemotactic protein-1 gene expression in human endometrial cells in cultures. Mol. Cell. Endocrinol., 107, 189197.[Web of Science][Medline]
Arici, A., Seli, E., Senturk, L.M., Gutierrez, L.S. and Oral, E. (1998) Interleukin-8 in the human endometrium. J. Clin. Endocrinol. Metab., 83, 17831787.
Baggiolini, M. and Dahinden, A. (1994) CC Chemokines in allergic inflammation. Inmmunol. Today, 15, 127133.
Barclay, C.G., Brennard, J.E., Kelly, R.W. and Calder, A.A. (1993) Interleukin-8 production by human cervix. Am. J. Obstet. Gynecol., 169, 625632.[Web of Science][Medline]
Bulmer, J.N., and Johnson, P.M. (1985) Immunohistological characterisation of the decidual leukocytic infiltrate related to endometrial gland epithelium in early human pregnancy. Immunology, 55, 3544.[Web of Science][Medline]
Bulmer, J.N., Morrison, L., Longfellow, M., Ritson, A. and Pace, D. (1991) Granulated lymphocytes in human endometrium: histochemical and immunohistochemical studies. Hum. Reprod., 6, 791798.
Chomczynski, P. and Sacchi, N. (1987) Single step method of RNA isolation by acid guanidinium thiocyanate phenolchloroform extraction. Anal. Biochem., 162, 156159.[Web of Science][Medline]
Critchley, H.O.D., Kelly, R.W. and Kooy, J. (1994) Perivascular localization of interleukin-8 in human endometrium: a preliminary report. Hum. Reprod., 8, 14061409.
Critchley, H.O.D, Kelly, R.W., Lea, R.G., Drudy, T.A., Jones, R.L. and Baird, D.T. (1996) Sex steriod regulation of leukocyte traffic in human decidua. Hum. Reprod., 11, 22572262.
Critchley, H.O.D., Jones, R.L., Lea, R.G., Drudy, T.A., Kelly, R.W., Williams, A.R. and Baird, D.T. (1999) Role of inflammatory mediators in human endometrium during progesterone withdrawal and early pregnancy. J. Clin. Endocrinol. Metab., 84, 240248.
De los Santos, M.J., Mercader, A., Francés, A., Portoles, E., Remohi, J., Pellicer, A. and Simon, C. (1996) Role of endometrial factors in regulating secretion of components of the immunoreactive human embryonic interleukin-1 system during embryonic development. Biol. Reprod., 54, 563574.[Abstract]
Del Pozo, M.A., Cabañas, C., Montoya, M.C., Ager, A., Sanchez-Mateos, P. and Sanchez-Madrid, F. (1997) ICAM's redistributed by chemokines to cellular uropods as a mechanism for recruitment of T-lymphocytes. J. Cell. Biol., 137, 493508.
Dudley, D.J., Trantman, M.S. and Mitchel, M.D. (1993) Inflammatory mediators regulate interleukin-8 production by cultured gestational tissues: evidence for a cytokine network at the choriodecidual interface. J. Clin. Endocrinol. Metab., 76, 404410.[Abstract]
Galán, A., O'Connor, J.E., Valbuena, D., Herrer, R., Remohi, J., Pampfer, S., Pellicer, A. and Simon, C. (2000) The human blastocyst regulates endometrial epithelial apoptosis in embryonic adhesion. Biol. Reprod., 63, 430439.
García-Velasco, J.A. and Arici, A. (1999) Interleukin-8 expression in endothelial stromal cells is regulated by integrin-dependent cell adhesion. Mol. Hum. Reprod., 5, 11351140.
García-Velasco, J.A, Seli, E. and Arici, A. (1999) Regulation of monocyte chemotactic protein-1 expression in human endometrial stromal cells by integrin-dependent cell adhesion. Biol. Reprod., 61, 548552.
Glasser, S.R., Mulholland, J. and Mani, S.K. (1991) Blastocyst endometrial relationships: reciprocal interactions between uterine epithelial and stromal cells and blastocysts. Trophoblast. Res., 5, 225280.
Hornung, D., Ryan, I.P., Chao, V.A., Vigne, J.L., Schriock, E.D. and Taylor, R.N. (1997) Immunolocalization and regulation of the chemokine RANTES in human endometrial and endometriosis tissues and cells. J. Clin. Endocrinol. Metab., 82, 16211628.
Jones, R.L., Kelly, R.W. and Critchley, H.O.D. (1997) Chemokines and cyclooxygenase-2 expression in human endometrium coincides with leukocyte accumulation. Hum. Reprod., 12, 13001306.
Jung, T., Schauer, U., Heusser, C., Neumann, C. and Rieger, C. (1993) Detection of cytokines by flow cytometry. J. Immunol. Methods, 159, 197207.[Web of Science][Medline]
King, A., Gardner, L. and Loke, Y.W. (1996) Evaluation of oestrogen and progesterone receptors expression in uterine mucosal lymphocytes. Hum. Reprod., 11, 10791082.
Larsen, C., Anderson, A., Aella, E., Oppenheim, J.J. and Matsushima, K. (1989) The neutrophil-activating protein (NAP-1) is also chemotactic for T lymphocytes.Science, 243, 14641466.
Manni, A., Kleimberg, J., Ackerman, V., Bellini, A., Patalano, F. and Mattoli, S. (1996) Inducibility of RANTES mRNA by IL-1ß in human bronchial epithelial cells is associated with increased NF-kB DNA binding Activity. Biochem. Biophys. Res. Commun., 220, 120124.[Web of Science][Medline]
Matsushima, K., Monishita, K., Yoshimura, T., Lavu, S., Kobayashi, Y., Lew, W., Appella, E., Kung, H.F., Leonard, E.J. and Oppenheim, J.J. (1988) Molecular cloning of a human monocyte-derived neutrophil chemotactic factor (MDNCF) and the induction of MDNCF mRNA by IL-1 and tumor necrosis factor. J. Exp. Med., 167, 18831893.
Meseguer, M., Aplin, D., Caballero-Campo, P., O'Connor, J.E., Martin, J.C., Remohi, J., Pellicer, A. and Simon, C. (2001) Human endometrial mucin MUC1 is up-regulated by progesterone and down-regulated in vitro by the human blastocyst. Biol. Reprod., 64, 590601.
Milne, S.A., Critchley, H.O., Drudy, T.A., Kelly, R.W. and Baird, D.T. (1999) Perivascular interleukin-8 mRNA expression in human endometrium varies across the menstrual cycle and in early pregnancy deciduas. J. Clin. Endocrinol. Metab., 84, 25632567.
Mukaida, N., Shiroo, M. and Matsushima, K. (1989) Genomic structure of the human monocyte derived neutrophil chemotactic factor IL-8. J. Immunol., 143, 13661371.[Abstract]
Noyes, R.W., Hertig, A.T. and Rock, J. (1950) Dating the endometrial biopsy. Fertil. Steril., 1, 325.
Oppenheim, J., Zachaniae, C.O.C., Mukeida, N. and Matsushima, K. (1991) Properties of the novel proinflammatory supergene `intercine' cytokine family. Ann. Revol. Immunol., 9, 617648.
Prussin, C. and Metcalfe, D.D. (1995) Detection of intracytoplasmic cytokine using flow cytometry and directly conjugated anti-cytokine antibodies. J. Immunol. Methods, 188, 117128.[Web of Science][Medline]
Remohí, J., Gutiérrez, A., Cano, F., Ruiz, A., Simon, C. and Pellicer, A. (1995) Long oestradiol replacement in an oocyte donation programme. Hum. Reprod., 10, 13871391.
Robertson, S.A., Mayrhofer, G., and Seamark, F. (1996) Ovarian steroid hormones regulate granulocyte-macrophage colony-stimulating factor synthesis by uterine epithelial cells in the mouse. Biol. Reprod., 54, 183196.[Abstract]
Saito, S., Kasahara, T., Sakakura, S., Umekage, H., Harada, N. and Ichijo, M. (1994) Detection and localization of interleukin-8 mRNA and protein in human placenta and decidual tissues. J. Reprod. Immuol., 27, 161172.
Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, New York, USA.
Sica, A., Wang, J.M., Colotta, F., Dejana, E., Mantovani, A., Oppenheim, J.J., Larsen, C.G., Zachariae, C.O. and Matsushima, K. (1990) Monocyte chemotactic and activating factor gene expression induced in endothelial cells by interleukin-1 (IL-1) and tumor necrosis factor (TNF-
). J. Immunol., 144, 30343038.[Abstract]
Simón, C., Piquette, G., Francés, A., and Polan, M.L. (1993) Localization of interleukin-1 type 1 receptor and interleukin-1ß in human endometrium throughout the menstrual cycle. J. Clin. Endocrinol. Metab., 77, 549555.[Abstract]
Simón, C., Piquette, G.N., Francés, A., el-Danasouri, I., Irwin, J.C. and Polan, M.L. (1994) The effect of interleukin-1ß on the regulation of IL-1 receptor type 1 messenger ribonucleic acid and protein levels in cultured human endometrial stromal and glandular cells. J. Clin. Endocrinol. Metab., 78, 675682.[Abstract]
Simón, C., Gimeno, M.J., Mercader, A., Frances, A., Garcia-Velasco, J., Remohi, J., Polan, M.L. and Pellicer, A. (1996) Cytokines adhesion molecules-invasive proteinases. The missing paracrine/autocrine link in embryonic implantation? Mol. Hum. Reprod., 2, 405424.
Simón, C., Gimeno, M.J., Mercader, A., O'Connor, J.E., Remohi, J., Polan, M.L. and Pellicer, A. (1997) Embryonic regulation of integrins ß3,
4 and
1 in human endometrial epithelial cells in vitro. J. Clin. Endocrinol. Metab., 82, 26072616.
Simón, C., Caballero-Campo, P., García-Velasco, J.A. and Pellicer, A. (1998) Potential implications of chemokines in reproductive function: an attractive idea. J. Reprod. Immunol., 38, 169193.[Web of Science][Medline]
Simón, C., Mercader, A., García-Velasco, J.A., Nikas, G., Moreno, C., Remohi, J. and Pellicer, A. (1999) Coculture of human embryos with autologous human endometrial epithelial cells in patients with implantation failure. J. Clin. Endocrinol. Metab., 84, 26382646.
Tremellen, K.P., Seamark, R.F. and Robertson, S.A. (1998) Seminal transforming growth factor beta 1 stimulates granulocyte-macrophage colony-stimulating factor production and inflammatory cell recruitment in the murine uterus. Biol. Reprod., 58, 12171225.
Yoshimura, T. and Leonard, E.J. (1990) Secretion by human fibroblasts of monocyte chemoattractant protein-1, the product of the gene JE. J. Immunol., 144, 23772383.[Abstract]
Yoshimura, T., Yuhki, N. and Moore, S. (1989) Human monocyte chemoattractant protein 1 (MCP-1): full-length cDNA cloning, expression in mitogestimulated blood mononuclear leukocytes and sequence similarity to mouse competence gene JE. FEBS Lett., 244, 487493.[Web of Science][Medline]
Submitted on February 16, 2001; resubmitted on September 18, 2001; accepted on January 30, 2002.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S.-U. Chen, C.-H. Chou, K.-H. Chao, H. Lee, C.-W. Lin, H.-F. Lu, and Y.-S. Yang Lysophosphatidic Acid Up-Regulates Expression of Growth-Regulated Oncogene-{alpha}, Interleukin-8, and Monocyte Chemoattractant Protein-1 in Human First-Trimester Trophoblasts: Possible Roles in Angiogenesis and Immune Regulation Endocrinology, January 1, 2010; 151(1): 369 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.M. Boomsma, A. Kavelaars, M.J.C. Eijkemans, E.G. Lentjes, B.C.J.M. Fauser, C.J. Heijnen, and N.S. Macklon Endometrial secretion analysis identifies a cytokine profile predictive of pregnancy in IVF Hum. Reprod., June 1, 2009; 24(6): 1427 - 1435. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Arase, H. Uchida, T. Kajitani, M. Ono, K. Tamaki, H. Oda, S. Nishikawa, M. Kagami, T. Nagashima, H. Masuda, et al. The UDP-Glucose Receptor P2RY14 Triggers Innate Mucosal Immunity in the Female Reproductive Tract by Inducing IL-8 J. Immunol., June 1, 2009; 182(11): 7074 - 7084. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Fraccaroli, J. Alfieri, L. Larocca, M. Calafat, G. Mor, C. P. Leiros, and R. Ramhorst A potential tolerogenic immune mechanism in a trophoblast cell line through the activation of chemokine-induced T cell death and regulatory T cell modulation Hum. Reprod., January 1, 2009; 24(1): 166 - 175. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-U. Chen, H. Lee, D.-Y. Chang, C.-H. Chou, C.-Y. Chang, K.-H. Chao, C.-W. Lin, and Y.-S. Yang Lysophosphatidic Acid Mediates Interleukin-8 Expression in Human Endometrial Stromal Cells through Its Receptor and Nuclear Factor-{kappa}B-Dependent Pathway: A Possible Role in Angiogenesis of Endometrium and Placenta Endocrinology, November 1, 2008; 149(11): 5888 - 5896. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Shynlova, P. Tsui, A. Dorogin, and S. J. Lye Monocyte Chemoattractant Protein-1 (CCL-2) Integrates Mechanical and Endocrine Signals That Mediate Term and Preterm Labor J. Immunol., July 15, 2008; 181(2): 1470 - 1479. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Dominguez, S. Martinez, A. Quinonero, F. Loro, J.A. Horcajadas, A. Pellicer, and C. Simon CXCL10 and IL-6 induce chemotaxis in human trophoblast cell lines Mol. Hum. Reprod., July 1, 2008; 14(7): 423 - 430. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kallikourdis, K. G. Andersen, K. A. Welch, and A. G. Betz Alloantigen-enhanced accumulation of CCR5+ 'effector' regulatory T cells in the gravid uterus PNAS, January 9, 2007; 104(2): 594 - 599. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yoshioka, H. Fujiwara, T. Nakayama, K. Kosaka, T. Mori, and S. Fujii Intrauterine administration of autologous peripheral blood mononuclear cells promotes implantation rates in patients with repeated failure of IVF-embryo transfer Hum. Reprod., December 1, 2006; 21(12): 3290 - 3294. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Li, X. Luo, Q. Pan, I. Zineh, D. F. Archer, R.S. Williams, and N. Chegini Doxycycline alters the expression of inflammatory and immune-related cytokines and chemokines in human endometrial cells: implication in irregular uterine bleeding Hum. Reprod., October 1, 2006; 21(10): 2555 - 2563. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Hannan, R. L. Jones, C. A. White, and L. A. Salamonsen The Chemokines, CX3CL1, CCL14, and CCL4, Promote Human Trophoblast Migration at the Feto-Maternal Interface Biol Reprod, May 1, 2006; 74(5): 896 - 904. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Talbi, A. E. Hamilton, K. C. Vo, S. Tulac, M. T. Overgaard, C. Dosiou, N. Le Shay, C. N. Nezhat, R. Kempson, B. A. Lessey, et al. Molecular Phenotyping of Human Endometrium Distinguishes Menstrual Cycle Phases and Underlying Biological Processes in Normo-Ovulatory Women Endocrinology, March 1, 2006; 147(3): 1097 - 1121. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Dimitriadis, C.A. White, R.L. Jones, and L.A. Salamonsen Cytokines, chemokines and growth factors in endometrium related to implantation Hum. Reprod. Update, November 1, 2005; 11(6): 613 - 630. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Matorras, F. Matorras, R. Mendoza, M. Rodriguez, J. Remohi, F. J. Rodriguez-Escudero, and C. Simon The implantation of every embryo facilitates the chances of the remaining embryos to implant in an IVF programme: a mathematical model to predict pregnancy and multiple pregnancy rates Hum. Reprod., October 1, 2005; 20(10): 2923 - 2931. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Red-Horse, M. Kapidzic, Y. Zhou, K.-T. Feng, H. Singh, and S. J. Fisher EPHB4 regulates chemokine-evoked trophoblast responses: a mechanism for incorporating the human placenta into the maternal circulation Development, September 15, 2005; 132(18): 4097 - 4106. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Dominguez, M. Yanez-Mo, F. Sanchez-Madrid, and C. Simon Embryonic implantation and leukocyte transendothelial migration: different processes with similar players? FASEB J, July 1, 2005; 19(9): 1056 - 1060. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.V. Fahey, T.M Schaefer, J.Y. Channon, and C.R. Wira Secretion of cytokines and chemokines by polarized human epithelial cells from the female reproductive tract Hum. Reprod., June 1, 2005; 20(6): 1439 - 1446. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nagaoka, H. Nojima, F. Watanabe, K.-T. Chang, R. K. Christenson, S. Sakai, and K. Imakawa Regulation of Blastocyst Migration, Apposition, and Initial Adhesion by a Chemokine, Interferon {gamma}-inducible Protein 10 kDa (IP-10), during Early Gestation J. Biol. Chem., August 1, 2003; 278(31): 29048 - 29056. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Dominguez, A. Galan, J. J. L. Martin, J. Remohi, A. Pellicer, and C. Simon Hormonal and embryonic regulation of chemokine receptors CXCR1, CXCR4, CCR5 and CCR2B in the human endometrium and the human blastocyst Mol. Hum. Reprod., April 1, 2003; 9(4): 189 - 198. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||














