Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (38)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Sedlmayr, P.
Right arrow Articles by Dohr, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sedlmayr, P.
Right arrow Articles by Dohr, G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 8, No. 4, 385-391, April 2002
© 2002 European Society of Human Reproduction and Embryology


Implantation and pregnancy

Localization of indoleamine 2,3-dioxygenase in human female reproductive organs and the placenta

P. Sedlmayr1,6, A. Blaschitz1, R. Wintersteiger2, M. Semlitsch1, A. Hammer1, C.R. MacKenzie4, W. Walcher3, O. Reich3, O. Takikawa5 and G. Dohr1

1 Institut für Histologie und Embryologie, 2 Institut für Pharmazeutische Chemie 3 Geburtshilflich-gynäkologische Universitätsklinik, Karl-Franzens-Universität, Graz, Austria, 4 Institut für Mikrobiologie und Virologie, Heinrich-Heine-Universität, D-40225 Düsseldorf, Germany 5 Department of Pharmacology, Hokkaido University, Sapporo 060-8638, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Indoleamine 2,3-dioxygenase (IDO) has been implicated in regulation of feto-maternal tolerance and protection against intracellular and extracellular pathogens. We have studied the expression of IDO in the human female reproductive tract and the placenta by immunohistochemistry. Endometrial glandular and surface epithelial cells showed increasing IDO expression during the course of the menstrual cycle. In term placenta, IDO was irregularly localized to the mesenchymal core and found in isolated areas of the syncytiotrophoblast. In first trimester pregnancy, IDO was not present in placental villi, but was present in glandular epithelium of the decidua, and there were distinctly positive cells scattered in the connective tissue, sometimes in conjunction with lymphoid aggregates. The endothelium of spiral arteries and of capillaries showed some, albeit no generalized, reactivity. IDO was also present in the epithelium of cervical glands and of Fallopian tubes. Specificity of antibody binding was confirmed by Western blot analysis. IDO mRNA was detected in first trimester decidua as determined by RT–PCR. IDO is secreted, as determined by analysis of cervical mucus by high pressure liquid chromatography for the presence of the tryptophan metabolite L-kynurenine, indicating IDO activity. Our results support the concept of IDO providing a mechanism of innate immunity protecting against ascending infections in the female reproductive tract.

decidua/endometrium/feto-maternal tolerance/mucosal immunity/pregnancy


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Indoleamine 2,3-dioxygenase (IDO), a monomeric hemoprotein, is the initial and rate-limiting enzyme of the kynurenine pathway of degradation of L-tryptophan. IDO oxidizes the pyrrole moiety of tryptophan (Shimizu et al., 1978Go). Following stimulation with IFN-{gamma}, it is induced in various types of human cell lines and cell types such as fibroblasts, epithelial cells and macrophages (Takikawa et al., 1988Go; Carlin et al., 1989Go; Dai and Gupta, 1990aGo,bGo). High enzyme activity is present in the placenta, lung and small intestine (Yamazaki et al., 1985Go).

Recently, IDO has been implicated in the regulation of feto-maternal tolerance in the mouse. Following the blocking of IDO by 1-methyl-tryptophan, allogeneic but not syngeneic fetuses were found to be rejected. This was provoked by a single (paternally inherited) MHC-I difference and depended on the activity of maternal T-cells (Munn et al., 1998Go). Application of 1-methyl-tryptophan resulted in extensive inflammation, haemorrhagic necrosis, a T cell infiltrate and deposition of C3 at the murine materno-fetal interface (Mellor et al., 2001Go). IDO induced in M-CSF-derived macrophages or in monocyte-derived dendritic cells by IFN-{gamma} + CD40L and IDO present in human placental villous explants has been shown to inhibit T-cell proliferation via tryptophan depletion (Munn et al., 1999Go; Hwu et al., 2000Go; Kudo et al., 2001). In the absence of tryptophan, the cell cycle is arrested at a mid-G1 point (Munn et al., 1999Go).

With this context, we investigated the localization of IDO at the feto-maternal interface in human pregnancy.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Materials
The monoclonal antibody against human IDO (anti-IDO-Ab, IgG1 subclass) has been described previously (Takikawa et al., 1988Go)) and was used at final dilutions of 1:500 and 1:1000. Isotype-specific control antibodies were obtained from Sigma (St Louis, MO, USA) and Dako (Glostrup, Denmark) and used at a final concentration of 10 µg/ml. Non-immune mouse serum was from Dako (Vienna, Austria). Kynurenine and L-tryptophan were purchased from Sigma–Aldrich (Vienna, Austria) and Methylene Blue as well as ascorbic acid were from Fluka (Buchs, Switzerland). Catalase was from Roche Diagnostics (Darmstadt, Germany). Trichloroacetic acid and all other chemicals were of the highest purity commercially available. For solid-phase extraction, 500 mg octadecyl disposable extraction cartridges from Bakerbond (Deventer, The Netherlands) were used.

Tissues and cervical mucus
Our studies were approved by the Ethics Committee of the General Hospital–University Clinics and the Medical Faculty of the Karl-Franzens-University of Graz. Frozen and paraffin-embedded sections were obtained from human first trimester decidua (samples from five women) and from first trimester placenta (from six women). These tissues were obtained following termination of healthy pregnancies. Samples of term placenta including the basal plate (processed as cryosections or paraffin sections) and of term fetal membranes (for cryosections) were obtained (from seven and three women respectively) after birth. One sample of third trimester placenta was obtained following Caesarean section during the 34th week of pregnancy and was embedded in paraffin. Non-pregnant endometrium samples (from four women in the proliferative phase and six women in the secretory phase) were obtained by punch biopsy from patients with myomas (at the Department of Obstetrics and Gynecology of the Hospital Barmherzige Brüder in Graz) and were used to prepare cryosections. Frozen or paraffin sections from the cervix of four patients were obtained after hysterectomy due to ovarian carcinoma (two patients) or endometrial carcinoma (two patients). Paraffin sections of Fallopian tubes from three post-menopausal women were obtained after hysterectomy due to endometrial carcinoma, atypical endometrial hyperplasia plus uterine adenomyosis or cervical carcinoma. The Fallopian tubes were normal in each of these cases. Cervical mucus was obtained from 22 consenting women aged 34 ± 13.3 years (mean ± SD) on routine cancer screening at the outpatient clinic of the Department of Obstetrics and Gynecology at the University Hospital of Graz.

Immunohistochemistry
Cryosections fixed with acetone or 1% formalin and paraffin sections from archival material which had been fixed with 4% paraformaldehyde, 10% formol or Bouin fixative were studied. In general, frozen tissue is least subject to artefactual staining, while paraffin-embedded tissue gives much better morphology. So wherever possible, both methods were used. Paraffin sections (5 µm) were collected on adhesive slides, deparaffinized in xylene, rehydrated and cooked in a microwave oven (2x5 min at 750 W) using 0.01 mol/l citrate buffer at pH 6.0 for antigen retrieval. Tissues were incubated with the IDO antibody at room temperature for 30 min. Detection of antibody binding was done using horse-radish peroxidase-labelled biotin–streptavidin systems: either LSABplus kit (Dako, Vienna, Austria) or Ultra Vision kit (Lab Vision, Fremont, CA, USA); alternatively goat anti-mouse Ig conjugated to peroxidase-labelled dextran polymer was used (EnVision+; Dako). AEC (amino-ethyl-carbazole) or DAB (3,3'-diaminobenzidine) were used as chromogenic substrates for cryosections and paraffin sections respectively. Endogenous peroxidase was blocked in a mixture of NaN3 and 0.3% H2O2 for cryosections or in 3% H2O2 for paraffin sections, and non-specific antibody binding was prevented by preincubation in 10% heat-inactivated human AB serum from healthy donors pretested to be free of human anti-mouse antibodies. The slides were counterstained with haemalum.

SDS–PAGE and Western blotting
Western blotting was performed on homogenates of decidual tissue from the first trimester of pregnancy as described (Hammer et al., 1997Go). Briefly, decidual tissue was homogenized in liquid nitrogen, suspended in denaturating sodium dodecyl sulphate (SDS) sample buffer, heated for 15 min to 95°C and centrifuged for 15 min at 10 000 g. Protein content in the clear supernatant was estimated by a published method (Lowry et al., 1951Go). The samples were separated on 7.5–15% SDS gradient slab gels with a 5% stacking gel and then transferred to nitrocellulose membranes. The membranes were blocked with 4% non-fat dry milk and probed with anti-IDO-Ab at a concentration of 0.75 µg antibody/ml and afterwards with a peroxidase-labelled anti-mouse antibody (Jackson, ImmunoResearch Laboratories, Inc., PA, USA) at a concentration of 0.065 µg/ml. The resulting signal was visualized by enhanced chemiluminescence using the Super-Signal kit from Pierce (Rockford, IL, USA) according to the manufacturer's instructions. Negative controls were performed with normal mouse serum (Dako).

RT–PCR
Pieces of first trimester decidua (two samples) were visually identified under a stereo microscope, put into RNAlater (Ambion, Oxon, UK) for preservation of RNA and kept at –18°C until express shipping to the laboratory in Düsseldorf.

Cell lysis was performed using a published method (Chomczynski and Sacchi, 1987Go) and RNA was isolated by caesium chloride centrifugation. Briefly, decidual tissue was homogenized in PBS and the cells were harvested by centrifugation. The cell pellet was then resuspended in 4 ml guanidinium isothiocyanate to lyse the cells and then well mixed with 3 ml of water treated with diethylpyrocarbonate. The RNA was separated by layering over CsCl in an ultracentrifugation tube (Beckman) and centrifuged at 150 000 g for 16 h (Sambrook et al., 1989Go). The resulting RNA was washed with 75% ethanol, resuspended in diethylpyrocarbonate treated water and used for cDNA synthesis.

cDNA was synthesized using a 1st Strand cDNA-synthesis kit from Clontech (BD Biosciences Clontech, Heidelberg, Germany) following the instructions of the manufacturer and using 1.13 µg RNA. From the cDNA synthesis, 5 µl were used in the RT–PCR. IDO primer sequences were chosen to span multiple introns and thus exclude the chance of amplifying genomic DNA. The sequences used were: GCAAATGCAAGAACGGGACACT (upstream); TCAGGGAGACCAGAGCTTTCACAC (downstream). Amplification took place in a thermocycler as follows: 95°C for 4 min, then 95°C for 30 s, 62°C for 30 s, and 72°C for 1 min for 30 cycles followed by 72°C for 5 min.

GAPDH (glyceraldehyde 3-phosphate dehydrogenase) control primers were purchased from Clontech, Human Control Amplifyer Set and used according to the manufacturer's instructions.

The amplicons were separated on a 1% agarose gel and visualized using ethidium bromide and ultra-violet exposure

Determination of L-kynurenine and IDO activity in cervical mucus by HPLC
IDO activity was determined by high-performance liquid chromatography (HPLC)/UV detection by a modified procedure based on previous reports (Takikawa et al., 1988Go; Kudo et al., 2000Go). Cervical mucus (0.015–0.25 g) was diluted to 100 µl, preincubated at 37°C for 5 min and added to a preincubated reaction mixture composed of 100 µl Methylene Blue (25 µmol/l), 100 µl ascorbic acid (20 mmol/l), 100 µl L-tryptophan solution (0.4 mmol/l), 50 µl catalase and 650 µl potassium phosphate buffer (pH 6.5, 50 mmol/l). Following an incubation for 30 min at 37°C the reaction was terminated by adding 2 ml of 10% (w/v) trichloroacetic acid and further incubated at 50°C for 30 min in order to hydrolyse N-formylkynurenine formed by IDO to kynurenine. The reaction mixture was centrifuged for 15 min at 1520 g.

The cartridges were preconditioned with 3 ml methanol and 3 ml water and the complete clear supernatant reaction mixture was transferred for solid-phase extraction. To remove interfering by-products, 2.5 ml water was used as wash solution. Then 2 ml ethanol 40% and 2 ml acetonitrile 50% were taken for elution. This eluate was dried by nitrogen and redissolved in 100 µl mobile phase for HPLC analysis.

The HPLC system consisted of a L-6000 Merck Hitachi pump, a L-4250 UV-VIS detector and a Rheodyne 7125 injector with a 50 µl loop. The precolumn was packed with LiChrosorb RP 18, 5 µm, 5x4.6 mm. The analytical column was a Brownlee Lab RP 18, Speri 5 µm, 100x4.6 mm. Chromatograms were recorded with a LKB 2210 2-Channel Recorder. Injections were via a 100 µl Hamilton syringe. The mobile phase was a mixture of ammonium acetate (10 mmol/l) and methanol (90/10) and was filtered through a 0.2 µm membrane and degassed with helium of highest purity before use. Kynurenine having a retention time of 3.8 min was detected by its absorbance at 360 nm. For quantitative determinations, which were performed in duplicate, a standard curve was prepared by adding known amounts of kynurenine (corresponding to 25–1000 ng/injection) to the reaction mixture.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Immunolocalization of IDO:
In general, similar results were obtained with both frozen and paraffin tissue with all three immunohistochemistry detection kits.

Placental villi
In villi of first trimester pregnancy, no staining was detected (Figure 1dGo). In term placenta, however, there were scattered areas of reactivity with the IDO antibody. Villous endothelial cells were found to be positive (the staining intensity ranging between very weak and strong), and there was also irregular staining of the mesenchymal core of terminal villi. Staining of the syncytiotrophoblast was comparatively rare (Figure 1aGo).



View larger version (136K):
[in this window]
[in a new window]
 
Figure 1. Immunolocalization of indoleamine 2,3-dioxygenase (IDO). (a) In term placenta, irregular reactivity with the anti-IDO antibody was observed. Villous endothelial cells stained positive in many locations (red arrows), and there was also staining of the mesenchymal core in a minority of terminal villi. Staining of the syncytiotrophoblast was comparatively rare (green arrow). Cryosection, original magnification (OM) x40, scale bar = 50 µm. Insert: villous endothelium, paraffin section, OM x63. (c) Lack of staining in the basal plate of a term placenta (OM x20, scale bar = 100 µm, cryosection) and in (d) first trimester placental villi (cryosection, OM x20, scale bar = 100 µm). (e) Basal decidua at first trimester. The glandular epithelium is reactive (paraffin section, OM x10, scale bar = 200 µm). Insert: same section showing staining for IDO in apical as well as in basal parts of glandular epithelial cells (OM x63). (g) A lymphocytic aggregate in first trimester basal decidua contains some reactive cells (paraffin section, OM x40, scale bar = 50 µm). The red arrow points to reactive arteriolar endothelium. (i) Reactivity with the endothelium of spiral arteries (paraffin section, OM x63, scale bar = 32 µm). (k) Non-pregnant endometrium in the early secretory phase. Surface as well as glandular epithelium is positive (cryosection, OM x10, scale bar = 200 µm). (m) Reactivity of the epithelium of the Fallopian tube (paraffin section, OM x10, scale bar = 200 µm). (o) Gland in the uterine cervix, the epithelium (predominantly basal staining) and some cells scattered in the connective tissue are positive (paraffin section, OM x40, scale bar = 50 µm). (b) Cryosection, OM x20, scale bar = 100 µm, (f) paraffin section, OM x10, scale bar = 200 µm, (h) paraffin section, OM x40, scale bar = 50 µm, (j) paraffin section, OM x63, scale bar = 32 µm, (l) cryosection, OM x10, scale bar = 200 µm, (n) paraffin section, OM x10, scale bar = 200 µm and (p) paraffin section, OM x40, scale bar = 50 µm, each represent isotype controls corresponding to the positively stained sections to the left.

 
Basal decidua
Cells in the basal plate of term placenta did not stain for IDO (Figure 1cGo). In contrast, in first trimester decidua, IDO was distinctly present in most of the glandular epithelium (Figure 1eGo). In addition, there were few distinctly positive cells scattered in the connective tissue, sometimes in conjunction with cell aggregates consisting predominantly of lymphocytes (Figure 1gGo). The endothelium of spiral arteries (Figure 1iGo) and of capillaries (Figure 1gGo) showed some, albeit no generalized, reactivity.

Non-pregnant endometrium
During the proliferative phase, there was no or weak staining of the surface epithelium, while endometrial glands were mostly negative (not shown). During the secretory phase, strong staining of the surface epithelium was observed. Staining intensity of the glandular epithelium ranged between strong and absent (Figure 1kGo). Sometimes staining was present also in the glandular lumen.

Uterine cervix
The epithelium of cervical glands studied displayed a very irregular reactivity, with the IDO antibody in rather few scattered positive areas. In addition, a number of cells in the stroma were positively stained (Figure 1oGo). The squamous epithelium of the ectocervix stained negative (not shown).

Fallopian tubes
The epithelium of (post-menopausal) tubes was reactive with the IDO antibody (Figure 1mGo). We also found positivity in the mesothelium of the serosa adjacent to a mononuclear infiltrate (not shown).

Western blot confirmation of antibody specificity
The specificity of antibody reactivity was confirmed by Western blotting, where a specific band at 45 kDa was found, corresponding to the mol. wt of IDO. Another band at a lower mol. wt which was found with the IDO antibody as well as with the control (normal mouse serum) and this corresponds to a denaturation dependent antigen (Figure 2Go). As the control did not bind to tissue sections, we conclude that binding of the IDO antibody to the tissue sections is due to the 45 kDa antigen only.



View larger version (101K):
[in this window]
[in a new window]
 
Figure 2. Western blot of first trimester decidua using the anti-indoleamine 2,3-dioxygenase (IDO) antibody and a control (non-immune mouse serum). The anti-IDO antibody results in a specific band at 45 kDa. A second band at a lower mol. wt which was found with the anti-IDO antibody as well as with the control corresponds to a denaturation-dependent antigen, as the mouse serum did not react in immunohistology.

 
IDO mRNA expression
Total RNA from the one tissue sample of first trimester decidua was 0.4 µg and for the second tissue sample, 5.6 µg. From the latter, 1 and 2 µg were used for RT–PCR as shown in Figure 3Go. The total amount of RNA from the first sample was tested in an RT–PCR and was positive (data not shown). IFN-{gamma}-stimulated and unstimulated monocyte-derived macrophages were used as positive and negative controls respectively for the detection of IDO mRNA. GAPDH was co-amplified as a control of RNA quality and quantity. As shown by the GAPDH amplification, the RNA in both decidual tissues was most likely slightly degenerated; however, in both samples IDO mRNA was still detected. In lanes 3 and 4 decidua (1 and 2 µg respectively) there was a weak band of the expected size, indicating the presence of IDO mRNA in the tissue (Figure 3Go).



View larger version (61K):
[in this window]
[in a new window]
 
Figure 3. Identification of indoleamine 2,3-dioxygenase (IDO) (464 bp fragment) and GAPDH (983 bp fragment) mRNA in unstimulated (lane 2) and stimulated (lane 3) monocyte-derived macrophages (MDM), and in first trimester decidua (1 µg RNA: lane 4; 2 µg RNA: lane 5). Molecular weight markers are shown in lane 1. As shown by the GAPDH amplification, the RNA in the decidual tissue was most likely slightly degenerated; however, in both of the decidua samples, IDO mRNA was detected.

 
Kynurenine presence and IDO activity in the cervical mucus
In order to determine whether IDO is secreted by uterine glands onto the inner surface of the uterus, we chose to analyse the cervical mucous plug as this is easier to obtain than the secretory product of the glands of the uterine fundus, and since expression of IDO could be detected in cervical glandular epithelium, albeit to a much lower degree. In one out of 22 samples, the mucus was too viscous for analysis. In 12 of 21 specimens evaluated, kynurenine was found after addition of L-tryptophan (mean of all samples ± SD, in relation to a reaction time of 1 h: 24.21 ± 44.40 nmol/g). In four of 13 samples, kynurenine was also detectable before the addition of L-tryptophan (mean of all samples ± SD: 13.79 ± 39.35 nmol/g). IDO (L-tryptophan) degrading activity, indicated by an increase of kynurenine following the addition of L-tryptophan, was found in seven out of 13 samples tested (mean of all samples ± SD: 14.91 ± 20.24 nmol/h/g) (Table IGo). The data available did not show an association between the concentration of kynurenine or the activity of IDO and the phase of the menstrual cycle or the hormonal contraceptive use.


View this table:
[in this window]
[in a new window]
 
Table I. Kynurenine and indoleamine 2,3-dioxygenase (IDO) activity in cervical mucus
 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
As the feto-maternal interface consists of the apical surface of the syncytiotrophoblast as the contact zone to maternal blood on the one hand and the extravillous cytotrophoblast as the contact zone to maternal tissue on the other, expression of an enzyme mediating feto-maternal tolerance is likely to be expressed at these locations. In contrast to other results (Kamimura et al., 1991Go), we found IDO located in the placenta in the core of terminal villi rather than in the syncytiotrophoblast during term pregnancy. Consistent with our findings, Kudo and Boyd have found, by using cell fractionation, that IDO activity is negatively enriched in isolated brush border microvillous plasma membranes of placental syncytiotrophoblast (Kudo and Boyd, 2000Go). IDO activity in cultured human placental chorionic villi could be modulated by IFN-{gamma} (Kudo et al., 2000Go).

One would expect that the question of whether the fetal semi-allograft is tolerated or rejected would be resolved early in pregnancy. Interestingly, IDO was not present in placental villi in first trimester samples, at least not from the ninth week of pregnancy, our earliest specimen tested. This is in line with an earlier report describing that detectability of IDO activity in the human placenta starts at around the 14th week (Kamimura et al., 1991Go). It is also compatible with a recent report on the measurement of tryptophan in conditioned media from placental villous explants, demonstrating that tryptophan is strikingly reduced in conditioned media from term placenta explants but reduced very little in conditioned media from villous explants from first trimester placentas. Stimulation of both first trimester and term placenta villi with IFN-{gamma} enhances the tryptophan degradation, suggesting that expression of IDO can be induced or enhanced by IFN-{gamma} in villi of both early and late pregnancy (Kudo et al., 2001Go).

Expression of IDO protein in first trimester decidua is a new finding. The enzyme is predominantly located in the glandular epithelium, and is in fact present before pregnancy during the secretory phase of the menstrual cycle. (It should be mentioned here that reactivity with anti-IDO is quite variable between different uterine glands even within the same section.) In addition, the endometrial surface epithelium also contains IDO. The presence of IDO in first trimester decidua has been confirmed by Western blotting and RT–PCR. As IFN-{gamma} induces expression of IDO in many cell types, it is of interest that our findings correlate with the reported expression of IFN-{gamma} by endometrial glandular epithelium during the secretory phase (Chiang and Hill, 1997Go). IDO expression in glandular epithelium suggests that the enzyme is secreted. In order to address this question and because the secretory product of glands of the uterine fundus is not readily available, we examined the cervical mucous plug instead, since some IDO was also found in the epithelium of cervical glands by immunohistochemistry. As IDO activity was detected at a low level in some samples of cervical mucus we conclude that IDO is in fact secreted by glandular epithelium. (We are not able to say to what extent the secretion of IDO by the glands of the uterine fundus contributes to the IDO present in the cervical mucus, or whether it is due solely to IDO secretion by cervical glands.) The secretion of IDO by the uterine cervical glands provides at least circumstantial evidence that IDO is also present in the secretory product of the glands of the uterine fundus. It should be taken into account that expression of IDO was generally lower and only focally present in cervical glandular epithelium in comparison with that in endometrial glands during secretory phase. Since the amount of kynurenine or IDO activity found differed strongly between the individual samples of mucus, we suspect that the concentrations may be subject to hormonal and/or microbial influences.

Is there a function of IDO in the epithelium of secretory endometrium, Fallopian tube and decidua and in the uterine mucus and possibly also in the tubal mucus? On one hand, there is the aspect that during implantation, the blastocyst comes into contact with IDO-expressing surface epithelium and probably also IDO-containing glandular secretion products. It is unclear in what terms this relates to the development of feto-maternal tolerance. On the other hand, IDO may also have different functions. Induction of IDO by IFN-{gamma} blocks growth of intracellular parasites (Toxoplasma gondii, Chlamydia psittaci) by depletion of tryptophan (Byrne et al., 1986Go; Thomas et al., 1993Go). In addition, an extracellular antibacterial effect of IDO has been described as inhibiting the growth of enterococci by IFN-{gamma}-activated human uro-epithelial cells (MacKenzie et al., 1999Go). We thus speculate that IDO, as a product of uterine glands and also the constitutive expression of IDO in the epithelium, may help to protect the female reproductive tract against ascending bacterial and parasitic infections by limiting the availability of tryptophan from exogenous sources.

Apart from the epithelial expression, the presence of IDO at the feto-maternal interface during early pregnancy is restricted to a few scattered cells (a minority of macrophages?) in the connective tissue and to vascular endothelium of the decidua. Interestingly, some of these positive cells in the connective tissue were found in lymphocytic aggregates which are reported to contain a B cell core surrounded by CD8+ T cells with an outer halo of macrophages and are associated with lymphatic vessel termini (Yeaman et al., 2001aGo,bGo). This raises the question of whether cells secreting IDO may affect the reactivity of adjacent T cells in the lymphoid aggregate.

It has been proposed that degradation of L-tryptophan by IDO reduces the amount of tryptophan available to make the vasoconstrictor serotonin (Bonney and Matzinger, 1998Go). Presence of IDO in endothelial cells thus may contribute to maintaining blood vessel dilation.

There are open questions concerning the role of degradation of L-tryptophan for human feto-maternal tolerance. There are no data about expression of IDO in the developing placenta and decidua during the first weeks following implantation. Furthermore, the role of TDO (tryptophan 2,3-dioxygenase), an enzyme which is found earlier and with a higher activity in murine concepti, and catalysing the same step but not being blocked by 1-methyl-tryptophan, is unknown (Suzuki et al., 2001Go). Finally, the function of 1-methyl-tryptophan is not restricted to the blocking of IDO, as it also inhibits transport of L-tryptophan into the trophoblast (Kudo and Boyd, 2001aGo, 2001bGo). Thus the full effects of IDO (and TDO) on L-tryptophan availability at the feto-maternal interface requires further investigation.


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
We are grateful to Ms Christine Daxböck and Ms Sabine Richter for expert technical assistance, to Dr Christine Helige for providing material and to Dr Michaele Hartmann and Rudolf Schmied for help with taking photographs.


    Notes
 
6 To whom correspondence should be addressed at: Institut für Histologie und Embryologie, Karl-Franzens-Universität, Harrachgasse 21, A-8010 Graz, Austria. E-mail: peter.sedlmayr{at}kfunigraz.ac.at Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Bonney, E.A. and Matzinger, P. (1998) Much IDO about pregnancy. Nat. Med., 4, 1128–1129.[ISI][Medline]

Byrne, G.I., Lehmann, L.K. and Landry, G.J. (1986) Induction of tryptophan catabolism is the mechanism for gamma-interferon-mediated inhibition of intracellular Chlamydia psittaci replication in T24 cells. Infect. Immun., 53, 347–351.[Abstract/Free Full Text]

Carlin, J.M., Borden, E.C., Sondel, P.M. and Byrne, G.I. (1989) Interferon-induced indoleamine 2,3-dioxygenase activity in human mononuclear phagocytes. J. Leukoc. Biol., 45, 29–34.[Abstract]

Chiang, C.M. and Hill, J.A. (1997) Localization of T cells, interferon-gamma and HLA-DR in eutopic and ectopic human endometrium. Gynecol. Obstet. Invest., 43, 245–250.[ISI][Medline]

Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156–159.[ISI][Medline]

Dai, W. and Gupta, S.L. (1990a) Regulation of indoleamine 2,3-dioxygenase gene expression in human fibroblasts by interferon-gamma. Upstream control region discriminates between interferon-gamma and interferon-alpha. J. Biol. Chem., 265, 19871–19877. [Published erratum appears in J. Biol. Chem. (1992 Aprril 15), 267(11), 7956.][Abstract/Free Full Text]

Dai, W. and Gupta, S.L. (1990b) Molecular cloning, sequencing and expression of human interferon-gamma-inducible indoleamine 2,3-dioxygenase cDNA. Biochem. Biophys. Res. Commun., 168, 1–8.[ISI][Medline]

Hammer, A., Hutter, H., Blaschitz, A., Mahnert, W., Hartmann, M., Uchanska-Ziegler, B., Ziegler, A. and Dohr, G. (1997) Amnion epithelial cells, in contrast to trophoblast cells express all classical HLA class I molecules together with HLA-G. Am. J. Reprod. Immunol., 37, 161–171.

Hwu, P., Du, M.X., Lapointe, R., Do, M., Taylor, M.W. and Young, H.A. (2000) Indoleamine 2,3-dioxygenase production by human dendritic cells results in the inhibition of T cell proliferation. J. Immunol., 164, 3596–3599.[Abstract/Free Full Text]

Kamimura, S., Eguchi, K., Yonezawa, M. and Sekiba, K. (1991) Localization and developmental change of indoleamine 2,3-dioxygenase activity in the human placenta. Acta Med. Okayama, 45, 135–139.

Kudo, Y. and Boyd, C.A. (2000) Human placental indoleamine 2,3-dioxygenase: cellular localization and characterization of an enzyme preventing fetal rejection. Biochim. Biophys. Acta, 1500, 119–124.[Medline]

Kudo, Y. and Boyd, C.A. (2001a) Characterisation of L-tryptophan transporters in human placenta: a comparison of brush border and basal membrane vesicles. J. Physiol., 531, 405–416.[Abstract/Free Full Text]

Kudo, Y. and Boyd, C.A. (2001b) The role of L-tryptophan transport in L-tryptophan degradation by indoleamine 2,3-dioxygenase in human placental explants. J. Physiol., 531, 417–423.[Abstract/Free Full Text]

Kudo, Y., Boyd, C.A., Sargent, I.L., Redman, C.W. (2000) Modulation of indoleamine 2,3-dioxygenase by interferon-gamma in human placental chorionic villi. Mol. Hum. Reprod., 6, 369–374.[Abstract/Free Full Text]

Kudo, Y., Boyd, C.A.R., Sargent, I.L. and Redman, C.W. (2001) Tryptophan degradation by human placental indoleamine 2,3-dioxygenase regulates lymphocyte proliferation. J. Physiol., 535, 207–215.[Abstract/Free Full Text]

Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randall, R.J. (1951) Protein measurement with the Folin phenol reagent. J. Biol. Chem., 193, 265–275.[Free Full Text]

MacKenzie, C.R., Hucke, C., Müller, D., Seidel, K., Takikawa, O. and Daubener, W. (1999) Growth inhibition of multiresistant enterococci by interferon-gamma-activated human uro-epithelial cells. J. Med. Microbiol., 48, 935–941.[Abstract]

Mellor, A.L., Sivakumar, J., Chandler, P., Smith, K., Molina, H., Mao, D. and Munn, D.H. (2001) Prevention of T cell-driven complement activation and inflammation by tryptophan catabolism during pregnancy. Nat. Immunol., 2, 64–68.[ISI][Medline]

Munn, D.H., Zhou, M., Attwood, J.T., Bondarev, I., Conway, S.J., Marshall, B., Brown, C. and Mellor, A.L. (1998) Prevention of allogeneic fetal rejection by tryptophan catabolism [see comments]. Science, 281, 1191–1193.[Abstract/Free Full Text]

Munn, D.H., Shafizadeh, E., Attwood, J.T., Bondarev, I., Pashine, A. and Mellor, A.L. (1999) Inhibition of T cell proliferation by macrophage tryptophan catabolism. J. Exp. Med., 189, 1363–1372.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: a laboratory manual. Cold Spring Harbor Press, Cold Spring Harbor, 7–19 pp.

Shimizu, T., Nomiyama, S., Hirata, F., Hayaishi, O. (1978) Indoleamine 2,3-dioxygenase. Purification and some properties. J. Biol. Chem., 253, 4700–4706.[Abstract/Free Full Text]

Suzuki, S., Tone, S., Takikawa, O., Kubo, T., Kohno, I. and Minatogawa, Y. (2001) Expression of indoleamine 2,3-dioxygenase and tryptophan 2,3-dioxygenase in early concepti. Biochem. J., 355, 425–429.[ISI][Medline]

Takikawa, O., Kuroiwa, T., Yamazaki, F. and Kido, R. (1988) Mechanism of interferon-gamma action. Characterization of indoleamine 2,3-dioxygenase in cultured human cells induced by interferon-gamma and evaluation of the enzyme-mediated tryptophan degradation in its anticellular activity. J. Biol. Chem., 263, 2041–2048.[Abstract/Free Full Text]

Thomas, S.M., Garrity, L.F., Brandt, C.R. , Schobert, C.S., Feng, G.S., Taylor, M.W., Carlin, J.M. and Byrne, G.I. (1993) IFN-gamma-mediated antimicrobial response. Indoleamine 2,3-dioxygenase-deficient mutant host cells no longer inhibit intracellular Chlamydia spp. or Toxoplasma growth. J. Immunol., 150, 5529–5534.[Abstract]

Yamazaki, F., Kuroiwa, T., Takikawa, O. and Kido, R. (1985) Human indolylamine 2,3-dioxygenase. Its tissue distribution, and characterization of the placental enzyme. Biochem. J., 230, 635–638.[ISI][Medline]

Yeaman, G.R., Collins, J.E., Fanger, M.W. and Wira, C.R. (2001a) CD8+ T cells in human uterine endometrial lymphoid aggregates: Evidence for accumulation of cells by trafficking. Immunology, 102, 434–440.[ISI][Medline]

Yeaman, G.R., Collins, J.E., Wira, C.R. and Fanger, M.W. (2001b) Microanatomical and phenotypic characterization of human endometrial lymphoid aggregates. Am. J. Reprod. Immunol., 46, 28–29.

Submitted on August 6, 2001; accepted on December 6, 2001.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
K. Ino, E. Yamamoto, K. Shibata, H. Kajiyama, N. Yoshida, M. Terauchi, A. Nawa, T. Nagasaka, O. Takikawa, and F. Kikkawa
Inverse Correlation between Tumoral Indoleamine 2,3-Dioxygenase Expression and Tumor-Infiltrating Lymphocytes in Endometrial Cancer: Its Association with Disease Progression and Survival
Clin. Cancer Res., April 15, 2008; 14(8): 2310 - 2317.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Scheler, J. Wenzel, T. Tuting, O. Takikawa, T. Bieber, and D. von Bubnoff
Indoleamine 2,3-Dioxygenase (IDO): The Antagonist of Type I Interferon-Driven Skin Inflammation?
Am. J. Pathol., December 1, 2007; 171(6): 1936 - 1943.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
A. Ueno, S. Cho, L. Cheng, J. Wang, S. Hou, H. Nakano, P. Santamaria, and Y. Yang
Transient Upregulation of Indoleamine 2,3-Dioxygenase in Dendritic Cells by Human Chorionic Gonadotropin Downregulates Autoimmune Diabetes
Diabetes, June 1, 2007; 56(6): 1686 - 1693.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
N. Miwa, S. Hayakawa, S. Miyazaki, S. Myojo, Y. Sasaki, M. Sakai, O. Takikawa, and S. Saito
IDO expression on decidual and peripheral blood dendritic cells and monocytes/macrophages after treatment with CTLA-4 or interferon-{gamma} increase in normal pregnancy but decrease in spontaneous abortion
Mol. Hum. Reprod., December 1, 2005; 11(12): 865 - 870.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Okamoto, T. Nikaido, K. Ochiai, S. Takakura, M. Saito, Y. Aoki, N. Ishii, N. Yanaihara, K. Yamada, O. Takikawa, et al.
Indoleamine 2,3-Dioxygenase Serves as a Marker of Poor Prognosis in Gene Expression Profiles of Serous Ovarian Cancer Cells
Clin. Cancer Res., August 15, 2005; 11(16): 6030 - 6039.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Shao, A. R. Jacobs, V. V. Johnson, and L. Mayer
Activation of CD8+ Regulatory T Cells by Human Placental Trophoblasts
J. Immunol., June 15, 2005; 174(12): 7539 - 7547.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
Y. Kudo, T. Hara, T. Katsuki, A. Toyofuku, Y. Katsura, O. Takikawa, T. Fujii, and K. Ohama
Mechanisms regulating the expression of indoleamine 2,3-dioxygenase during decidualization of human endometrium
Hum. Reprod., May 1, 2004; 19(5): 1222 - 1230.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. M. Mackler, E. M. Barber, O. Takikawa, and J. W. Pollard
Indoleamine 2,3-Dioxygenase Is Regulated by IFN-{gamma} in the Mouse Placenta During Listeria monocytogenes Infection
J. Immunol., January 15, 2003; 170(2): 823 - 830.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (38)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Sedlmayr, P.
Right arrow Articles by Dohr, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sedlmayr, P.
Right arrow Articles by Dohr, G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?