Molecular Human Reproduction, Vol. 8, No. 6, 511-517,
June 2002
© 2002 European Society of Human Reproduction and Embryology
Testis and spermatogenesis |
Identification of testis development and spermatogenesis-related genes in human and mouse testes using cDNA arrays
1 Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing, 210029, 2 Institute of Genetics, Chinese Academy of Sciences, Shanghai, 101300, 3 Shanghai Institute of Cell Biology, Chinese Academy of Sciences, Shanghai, 200031, P.R.China, 4 Department of Microbiology, University of Alabama at Birmingham, Birmingham, Alabama 35294, USA, 5 Department of physiology, The Chinese University of Hong Kong, 2001 H.K. and 6 Institute of genetic resources, Nanjing Normal University, Nanjing, 210097, P.R.China
| Abstract |
|---|
|
|
|---|
We have constructed cDNA microarrays from the human testis large insert cDNA library, containing 9216 genes, together with several housekeeping genes. The cDNA microarrays were used to identify gene expression differences between human fetal and adult testes. Of >8700 hybridized clones, 731 exhibited significant differential expression characteristics. About 7500 genes were identified when the same cDNA microarrays were used for hybridization with cDNA probes from mouse testis, with 256 genes having significant differential expression between the age of 14 weeks. Among these genes, 101 were identified as critically related to testis development and possibly to spermatogenesis since they were found in both human and mouse testes, and expressed differentially at different stages of testis development. Of the 101 development-related genes, 59 full-length cDNAs have been sequenced previously, while the full-length cDNAs of the other 42 genes have not been published. We have obtained 11 full-length sequences of the 42 genes and deposited them in the GenBank. The conserved testis development-related genes found in both human and mouse testes may include genes that are likely to be involved in testicular functions, especially spermatogenesis, thus providing a basis for further functional characterization of the genes in mouse models.
cDNA array/development/spermatogenesis/testis
| Introduction |
|---|
|
|
|---|
The use of cDNA microarrays for a genome-wide approach to functional characterization of large numbers of genes and their expression profiles has increased rapidly (Bowtell, 1999
In the present study, we have employed microarray technology to investigate gene expression patterns in both human and mouse testes at different developmental stages. The testis is the primary male sex organ responsible for the production of sperm. Spermatogenesis is a well characterized developmental process from the prospermatogonia to the mature spermatozoon (Krawetz et al., 1999
), and is mainly regulated by genes uniquely expressed at different developmental stages. Several such genes have been previously identified (Grootegoed et al., 2000
). However, the majority of the genes related to the developmental stages of the testis and spermatogenesis remained largely unknown.
With the construction of cDNA microarrays from the human testis large insert cDNA library, we set out to examine the expression profile of large numbers of genes in human and mouse testes. There are only Sertoli cells and spermatogenous cells in the seminiferous tubules of 1-week-old mouse testis and 6-month-old human embryo testis, while seminiferous tubules of both 4-week-old mouse testis and human adult testis contain not only Sertoli cells and spermatogenous cells, but also various spermatogenic cells. Due to these broad differences in histological structures, transcripts from these two groups of subjects were compared to identify testis development and spermatogenesis-related genes through microarray hybridization. The homologous genes thus identified as showing differential expression patterns at different developmental stages in both human and mouse testes may be critically involved in testis development and spermatogenesis in both species. Therefore, further functional characterization of these genes in mouse models may prove advantageous in the understanding of spermatogenesis in humans.
| Materials and methods |
|---|
|
|
|---|
Construction and amplification of the cDNA plasmids of human testis
A human testis large insert cDNA library (catalogue number: HL5503U, source of insert cDNA: 25 Caucasians, aged 2564 years) was ordered from Clontech, Palo Alto, CA, USA. According to Clontech's Manual PT30031, each
TriplEx2 clone was converted to a pTriplEx2 clone in E. coli BM 25.8. To collect a set of representative independent clones, 12 000 positive phage plaques were randomly picked. Each clone was separately amplified in BM 25.8 bacteria again. After releasing phages by a modified Sambrook's method (Sambrook et al., 1989To extract the plasmids, 1.5 ml of cells was collected by centrifugation for 5 min at 8000 g. The supernatant was discarded and the cell pellet was completely resuspended with 200 µl of cell resuspension solution (pH 7.5, 50 mmol/l Tris, 10 mmol/l EDTA). Then, 200 µl of cell lysis solution [0.2 mol/l NaOH, 1% sodium dodecyl sulphate (SDS)] was added and stirred till clear. Finally, 200 µl of neutralization solution (3 mol/l potassium acetate) was added and mixed by inverting. The lysate was centrifuged at 13 000 g for 10 min. After 500 µl of the supernatant was transferred to a new tube, 500 µl isopropanol was added. The mixture was then incubated at room temperature for 30 min, followed by centrifugation at 13 000 g for 10 min. The supernatant was discarded, and the pellet was dissolved with 100 µl water. The plasmid samples were stored in 96-well trays at 70°C.
Preparation of the human testis cDNA microarrays
To produce DNA for spotting the microarray, the gene sequence was amplified from the plasmid clone by PCR. Primers (5'-primer: CCATTGTGTTGGTACCCGGGAATTCG, interval 6 bp to insert cDNA site; 3'-primer: ATAAGCTTGCTCGAGTCTAGAGTCGAC, interval 7 bp to insert cDNA site) were designed according to the 5' and 3' sequences of
TriplEx2 vector flanking the insert. In each 100 µl PCR reaction buffer (50 mmol/l KCl, 10 mmol/l TrisHCl, pH 8.4), 2 mmol/l MgCl2, 0.15 mmol/l dNTP, 4 IU Taq DNA polymerase, 25 pmol of each primer and 20 ng of plasmid DNA were added. The PCR reaction was carried out in a PE9600 Thermal Cycler under the following conditions: first denaturation at 94°C for 4 min, then each thermal cycle was in steps of 94°C for 30 s, 60°C for 30 s and 72°C for 3 min, with a final extension of 72°C for 10 min. A total of 35 cycles were conducted. To assess the quality of the results, 5 µl of the PCR product was assessed on a 0.8% agarose gel. If there were non-specific segments in the PCR product or the PCR product was too short to be full length, the clone was rejected. A total of 9216 PCR products selected from the PCR products of 12 000 clones were stored in a 96-well format at 20°C.
A cDNA array was assembled with the 9216 selected cDNA clones. Before spotting the PCR-produced cDNA on the membrane, 80 µl of isopropanol was added to each well containing 95 µl of sample and mixed thoroughly. The plate was then kept in a freezer at 20°C for 60 min. DNA was collected by centrifugation at 2000 g at 4°C for 30 min. The supernatant in each well was discarded and the pellet was dried by evaporation at room temperature. The DNA was denatured by addition of 10 µl denaturing solution (1.5 mol/l NaCl, 0.5 mol/l NaOH) to each well. The content of each well was transferred to 384-well trays and stored at 4°C before use.
Two dots for each DNA sample were spotted with a total of 18 432 dots for 9216 samples on 8x12 cm nylon membranes using an automatic arrayer (BioRobotics, Cambridge, UK). The membrane was dotted with
100 nl of PCR product in an area of 0.4 mm in diameter. DNA was cross-linked to the nylon membrane by UV light. Nine housekeeping genes were used as positive controls: (i) ribosomal protein s9; (ii) actin
; (iii) glyceral dehyde-3-phosphate dehydrogenase; (iv) hypoxanthine phosphoribosyl transferase 1; (v) H. sapiens mRNA for 23 kDa highly basic protein; (vi) ubiquitin c; (vii) phospholipase A2; (viii) ubiquitin carboxy; (ix) terminal esterase LI. pTriplEx2 DNA and puc 18 plasmid DNA were negative controls. The 12 spots for the same control cDNA were evenly distributed in the membranes.
Preparation of probe DNA using mRNA from human and mouse testes
Testes from human adults (n = 2) and 6-month-old fetuses (n = 3) were collected from the deceased or naturally aborted. Testes were also dissected from ICR mice at ages of 1 (n = 100) and 4 weeks (n = 10). After homogenization, total mRNA was extracted by trizol RNA isolation protocol (Gibco BRL, Grand Island, USA) and quantified with a UV spectrometer and electrophoresis. The PolyA+ mRNA was purified using an affinity column filled with poly(dT) resins (Qiagen, Hilden, Germany). The probes were prepared by incorporation of 33P-labelled dATP in a reverse transcription reaction using 2 µl of purified mRNA as the template, an oligo(dT) as the primer and M-MLV reverse transcriptase. Each labelling reaction was carried out with 200 µCi of
33P-dATP following the manufacturer's instruction (NEN Life Science, Boston, MA, USA).
Hybridization and signal scanning
Nylon membranes spotted with cDNA fragments were prehybridized with 20 ml of prehybridization solution [6xsaline sodium citrate (SSC), 0.5% SDS, 5xDenhardt, 100 µg/ml of denatured salmon sperm DNA] at 68°C for 3 h. Overnight hybridization with the 33P-labelled cDNA from testis samples was carried out in 6 ml of hybridization solution (6xSSC, 0.5% SDS, 100 µg/ml denatured salmon sperm DNA) and followed by stringent washing with 20 ml of wash solution (10% SSC, 0.5% SDS) at 65°C for 1 h. Membranes were exposed to a phosphor screen overnight and scanned using a FLA-3000A fluorescent image analyser (Fuji Photo Film, Tokyo, Japan). The radioactive intensity of each spot was linearly scanned with a 65 536 grey-grade in a pixel of 50 microns, and read out using the array gauge software (Fuji Photo Film). After subtraction of background (3 ± 3) chosen from an area where no cDNA was spotted, clones with intensities >10 were considered as positive signals to ensure that they were distinguished from background with statistical significance >99.9%. Hybridization data would be considered invalid if any of the 12 control spots for the same control cDNA had a 1.5-fold difference in its intensity between arrays. When the standard difference of the two dots for each DNA sample was <0.3, signals could be accepted by the software.
Sequencing of differentially expressed human testis cDNAs
The cDNA clones that expressed at the same reciprocal as demonstrated in both human and mouse cDNA microarray hybridization were selected for proliferation. The amplified cDNA plasmids were isolated and purified in mini-preps (QIAprep Spin Miniprep Kit; Qiagen) and the inserts were sequenced using the ABI 377 automatic sequencing machine. All resulting sequences were compared with sequences in GenBank by use of BLAST and an expect value cut-off of e(10).
| Results |
|---|
|
|
|---|
Differential expression of genes in human testes of adult and fetus
The main objective of the present study was to identify genes that are differentially expressed in the testes at different developmental stages, in this case fetus versus adult. When the human testis cDNA microarrays were hybridized with cDNA probes prepared from mRNA of human testes, positive signals were obtained from 8925 spots (
96.8% of the cDNA clones used in the microarrays) in the case of adult testis, and 8795 spots (
95.4% of the cDNA clones used in the microarrays) for fetal testis (Figure 1a,b
|
|
Differential expression of genes in mouse testes of different ages
Genes critically involved in development are likely to be conserved among mammalian species. The mouse was selected in this experiment for comparison with human genes so that genes expressed in both the human and mouse could be identified for further functional characterization in mouse models. The cDNA microarrays prepared from a human testis cDNA library were hybridized with probes prepared from mouse testis tissue, while keeping all the conditions the same. Signals were detected from 7524 spots (
81.6% of the cDNA clones) when using probes prepared from 4-week-old mouse testes, and 7468 spots (
81% of the cDNA clones) using probes prepared from 1-week-old mice (Figure 3a,b
|
|
Identification of development-related conserved genes in human and mouse testes
The genes that showed a great contrast between adult and fetus testes and were conserved at the same time between human and mouse are most likely to be important for development and possibly spermatogenesis. Based on this rationale, 160 cDNA clones were selected from common hybridization spots from both human and mouse testes exhibiting strong differential hybridization signals (>3-fold). Among these cDNA clones, 149 had an expression level higher in the adult than in the fetus, whereas for the other 11 cDNA clones, the reverse was true.
We sequenced the first 750 bases from the 160 cDNA clones and the resulting sequences were used in searching homologous human genes in GenBank using BLAST. A total of 101 unique cDNA sequences were found, with the rest being duplicates. Among the 101 unique genes, 54 full-length cDNA, five KIAA (see http://www.kazusa.or.jp/huge for information) and 42 expressed sequence tags (ESTs) had been previously deposited in GenBank. Out of the 42 reported EST, we completely sequenced 11 full-length cDNAs and deposited them in GenBank (accession numbers are AF306347, AF311324, AF387507, AF305686, AF311212, AY009108, AY014283, AY014282, AF350251, AF345909 and AF027525).
To have a global view of the development-related conserved genes in human and mouse testes, the relative expression levels of the 54 reported full-length genes are plotted in Figure 5
on the scale of their hybridization signals from the microarray analysis. To establish a functional profile of the 54 genes, proteins encoded by them were grouped into the following seven broad categories of biological roles: (i) cell signalling/cell communication (27.78%); (ii) cell division/DNA synthesis (27.78%); (iii) gene/protein expression (14.81%); (iv) metabolism (18.75%); (v) cell structure and motility (3.7%); (vi) cell/organism defence (5.56%); and (vii) unclassified (1.85%) (Table I
) (Adams et al., 1995
). It is likely that the other 42 selected genes, including the 11 full-length cDNA presently sequenced, may fall into these functional categories. In addition, mouse homologous genes of those 54 reported full-length genes were found in GenBank of NCBI, confirming our microarray hybridization results. The corresponding GenBank accession numbers are shown in Table I
.
|
|
| Discussion |
|---|
|
|
|---|
DNA microarray is a more advantageous tool for identification of uniquely expressed genes than the method of differential displayPCR, which is not very efficient due to non-specific redundant sequences and results in mostly a few hundred bases of the 3' end of the identified gene (Lockhart and Winzeler, 2000
A conventional way of organizing the cDNA source is to survey the EST libraries and select the genes that appear to be relevant to the experiment (Khan et al., 1999b
; Tanaka et al., 2000
). Gathering the EST library may involve pooling of data from different sources and attempting to reduce redundancy as practically as possible. Analysis of the EST sequence data is computationally intensive, and manipulation and transfer of data or cDNA from different quality standards may be concomitant with additional errors. This approach is usually associated with high labour and material costs if the EST clones have to be purchased from outside sources. More importantly, the completeness of the available EST sequences has its limitations and may not necessarily be representative of the subject under study. Many of the EST sequences are not full-length cDNAs.
Using the strategy of preparing a microarray directly from the cDNA library, we constructed microarrays using human testis large length cDNAs that have been cloned as a
phage library. The microarrays contained pairs of 9216 individual clones and 10 controls including cDNAs, from nine housekeeping genes and two plasmid DNAs. The hybridization of the microarrays with human and mouse testes of different developmental stages not only resulted in identification of differentially expressed testis genes that had been known previously, but also in the discovery of genes that had not been cloned or sequenced before. As the humanmouse comparative map becomes denser, it would be logical to construct the profile of homologous genes. The greatest value of homologous genes between the human and mouse is in identifying likely human or mouse homologues of gene functions and disease traits.
In this report, we used cDNA probes prepared from the mRNA of mouse testes to hybridize with human testis cDNA microarrays and demonstrated a positive signal from
81% of the total clones for both 1-week and 4-week mouse probes. This suggests that the expressed genes in the testis show a much greater homology between human and mouse compared with an average of 30% homology for genes expressed in other tissues (Koop, 1995
). An
4-fold difference between the numbers of genes that are predominantly expressed in adult and immature testes was observed in both human and mouse testes, despite a smaller number of unique genes expressed in the mouse. This may imply that the proportion of genes related to or governing development and/or spermatogenesis is the same in both human and mouse genomes. Among these genes, the present study has identified 160 clones with the same differential hybridization signals in both human and mouse, suggesting that these genes are conserved in the two species and likely to be essential for development and/or spermatogenesis.
To compare gene expression in 1- and 4-week mouse testes, it may be possible to include genes expressed in different germ cells and/or testicular somatic cells and related to mitotic divisions of spermatogonia, meiotic divisions of spermatocyte and spermiogenesis during spermatogenesis. The comparison of development-dependent gene expression profiles in human and mouse testes, as demonstrated in the present study using human testis cDNA microarrays, may help us to identify many critical genes related to spermatogenesis in both the human and mouse. We have identified 160 cDNAs exhibiting similar differential expression characteristics in both species, indicating a possibly essential role of these genes in the development of the testis and/or spermatogenesis.
Of the 160 clones, 101 have been found to be uniquely expressed genes, among which 54 have been listed as full-length cDNAs in GenBank, five are KIAA and 42 EST. Of the 54 full-length genes, 18.52% have been previously identified as spermatogenesis-specific; these include ODF2 (Shao et al., 1998
), CLGN (Watanabe et al., 1994
), AKAP4 (Mohapatra et al., 1998
), PGK2 (Zhang et al., 1999
), SCP1 (Kondoh et al., 1997
), HTTA (Tureci et al., 1998
), LDH4 (Primakoff, 1994
) and LDHc (Zinkham, 1972
). These genes were found again by our microarray analysis, validating the method we used here to identify testicular function-related genes. In addition, the 54 transcripts can be classified into several broad role categories, of which cell signalling/communication, cell division and DNA synthesis, and gene/protein expression can easily be associated with development and spermatogenesis. This analysis has provided an initial estimate of the functional profile of the genes identified in the present study. It is likely that the 42 unclassified clones identified in the present study may fall into the above functional categories, which may possibly be involved in spermatogenesis.
Furthermore, the 11 newly sequenced genes may be involved in various signal transductions, cell division and energy metabolism according to the domains in the deduced proteins. For instance, AF311312, containing a kinesin motor catalytic domain, might be a microtubule-dependent molecular motor which plays an important role in intracellular transport of organelles and in cell division. AY014282 with a calmodulin-binding domain might be involved in signal transduction. AF311324, having a ubiquitin domain, might mediate proteolysis which is related to the regulated turnover of proteins required for controlling cell cycle progression. Therefore, further functional studies of these new genes should shed light on the understanding of mechanisms underlining spermatogenesis or development.
It is interesting to note that the analysis of the expression pattern of the above-mentioned 54 genes has revealed a group of tumour genes which may belong to the class of cancertestis (CT) genes, genes that are expressed in a variety of human cancers but not in normal tissues, except for testis tissue. The tumour genes found in the 54 clones include: ubiquitin specific protease 6 (USP6) in some human cancer cells (Nakamura et al., 1992
); pericentriolar material 1 (PCM1) in hepotoma (Balczon et al., 1994
), colorectal cancers and non-small-cell lung cancers; human osteoinductive factor (hOIF) in human osteosarcoma cell lines (Madisen et al., 1990
); and HOM-TES-85-tumour antigen (HTTA) in astrocytomas (Tureci et al., 1998
). HTTA is not found in normal tissues except for the testis. The HTTA characteristic expression spectrum has been described for the T cell-defined MAGE, BAGE and GAGE gene products and led to the term CT antigen. The present finding that USP6, PCM1 and hOIF are also expressed in human testis suggests that they might be CT genes.
One possible link between cancer and the testis is that they are both heavily engaged in cell proliferation. This also lends strong support for our contention that the genes identified in the present study are development-related and possibly involved in spermatogenesis, a process which involves a great deal of germ cell proliferation and differentiation. Thus, the detailed understanding of functional roles of these CT genes may not only provide molecular mechanisms underlying testicular development and spermatogenesis, but may also reveal possible targets for the development of cancer vaccines.
In summary, the present study has paved the way to genome-wide functional characterization of genes related to testis development and spermatogenesis, and possibly to other testicular functions such as steroidogenesis. The finding of substantial numbers of overlapping genes showing significant differential expression patterns in both human and mouse testes provides a basis for functional elucidation of the development-related genes in mouse models for the understanding of the process of spermatogenesis in humans.
| Acknowledgements |
|---|
|
|
|---|
The research reported here was supported by a grant from China National 973 funded to J.H.S.
| Notes |
|---|
7 To whom correspondence should be addressed. E-mail: shajh{at}njmu.edu.cn
* Spermatogenesis study group, Hui Zhu1, Hu Zhu1, Yuxi Shan1, Min Lin1, Lirong Wang1, Lijun Cheng1, Yadong Zhou1and Yiquan Wang2 ![]()
1 Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing, 210029, ![]()
2 Institute of Genetic Resources, Nanjing Normal University, Nanjing 210097, PR China ![]()
| References |
|---|
|
|
|---|
Adams, M.D., Kerlavage, A.R., Fleischmann, R.D., Fuldner, R.A., Bult, C.J., Lee, N.H., Kirkness, E.F., Weinstock, K.G., Gocayne, J.D., White, O. et al. (1995) Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequence. Nature, 377, 1175.[Medline]
Balczon, R., Bao, L. and Zimmer, W.E. (1994) PCM-1, a 228-kD centrosome autoantigen with a distinct cell cycle distribution. J. Cell Biol., 124, 783793.
Bowtell, D.D. (1999) Options availablefrom start to finishfor obtaining expression data by microarray. Nature Genet., 21 (Suppl. 1), 2532.[Web of Science][Medline]
Debouck, C. and Goodfellow, P.N. (1999) DNA microarrays in drug discovery and development. Nature Genet., 21 (Suppl. 1), 4850.[Web of Science][Medline]
Donadel, G., Marinos, N., DeSilva, M.G., Lu, J., Notkins, A.L. and Lan, M.S. (1998) Molecular cloning and characterization of a highly basic protein, IA-4, expressed in pancreatic islets and brain. Neuroendocrinology, 67, 190196.[Web of Science][Medline]
Duggan, D.J., Bittner, M., Chen, Y., Meltzer, P. and Trent, J.M. (1999) Expression profiling using cDNA microarrays. Nature Genet., 21 (Suppl. 1), 1014.[Web of Science][Medline]
Eickhoff, H., Schuchhardt, J., Ivanov, I., Meier-Ewert, S., O'Brien, J., Malik, A., Tandon, N., Wolski, E.W., Rohlfs, E. and Nyarsik, L. (2000) Tissue gene expression analysis using arrayed normalized cDNA libraries. Genome Res., 10, 12301240.
Grootegoed, J.A., Siep, M. and Baarends, W.M. (2000) Molecular and cellular mechanisms in spermatogenesis. Baillieres. Best. Pract. Res. Clin. Endocrinol. Metab., 14, 331343.[Medline]
Khan, J., Bittner, M.L., Chen, Y., Meltzer, P.S. and Trent, J.M. (1999a) DNA microarray technology: the anticipated impact on the study of human disease. Biochem. Biophys. Acta., 1423, M17M28.[Medline]
Khan, J., Saal, L.H., Bittner, M.L., Chen, Y., Trent, J.M. and Meltzer, P.S. (1999b) Expression profiling in cancer using cDNA microarrays. Electrophoresis, 20, 223229.[Web of Science][Medline]
Kondoh, N., Nishina, Y., Tsuchida, J., Koga, M., Tanaka, H., Uchida, K., Inazawa, J., Taketo, M., Nozaki, M., Nojima, H. et al. (1997) Assignment of synaptonemal complex protein 1 (SCP1) to human chromosome 1p13 by fluorescence in situ hybridization and its expression in the testis. Cytogenet. Cell. Genet., 78, 103104.[Web of Science][Medline]
Koop, B.F. (1995) Human and rodent DNA sequence comparisons: a mosaic model of genomic evolution. Trends Genet., 11, 367371.[Web of Science][Medline]
Krawetz, S.A., Kramer, J.A. and McCarrey, J.R. (1999) Reprogramming the male gamete genome: a window to successful gene therapy. Gene, 234, 19.[Web of Science][Medline]
Lockhart, D.J. and Winzeler, E.A. (2000) Genomics, gene expression and DNA arrays. Nature, 405, 827831.[Medline]
Madisen, L., Neubauer, M., Plowman, G., Rosen, D., Segarini, P., Dasch, J., Thompson, A., Ziman, J., Bentz, H. and Purchio, A.F. (1990) Molecular cloning of a novel bone-forming compound: osteoinductive factor. DNA Cell Biol., 9, 303309.[Web of Science][Medline]
Marx, J. (2000) DNA arrays reveal cancer in its many forms. Science, 289, 16701672.
Mohapatra, B., Verma, S., Shankar, S. and Suri, A. (1998) Molecular cloning of human testis mRNA specifically expressed in haploid germ cells, having structural homology with the A-kinase anchoring proteins. Biochem. Biophys. Res. Commun., 244, 540545.[Web of Science][Medline]
Nakamura, T., Hillova, J., Mariage-Samson, R., Onno, M., Huebner, K., Cannizzaro, L.A., Boghosian-Sell, L. and Croce, C.M. (1992) A novel transcriptional unit of the tre oncogene widely expressed in human cancer cells. Oncogene, 7, 733741.[Web of Science][Medline]
Primakoff, P. (1994) Sperm proteins being studied for use in a contraceptive vaccine. Am. J. Reprod. Immunol., 31, 208210.
Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: a Lab Manual, 2nd edn. Cold Spring Harbor Laboratory Press, New York, USA.
Shao, X., Murthy, S., Demetrick, D.J. and van der Hoorn, F.A. (1998) Human outer dense fiber gene, ODF2, localizes to chromosome 9q34. Cytogenet. Cell Genet., 83, 221223.[Web of Science][Medline]
Smid-Koopman, E., Block, L.J., Chadha-Ajwani, S., Helmerhorst, T.J., Brinkmann, A.O. and Huikeshoven, G.J. (2000) Gene expression profiles of human endrometrial cancer samples using a cDNA-expression array technique: assessment of an analysis method. Br. J. Cancer, 83, 246251.[Web of Science][Medline]
Tanaka, T.S., Jaradat, S.A., Lim, M.K., Kargul, G.J., Wang, X., Grahovac, M.J., Pantano, S., Sano, Y., Piao, Y., Nagaraja, R. et al. (2000) Genome-wide expression profiling of mid-gestation placenta and embryo using a 15 000 mouse developmental cDNA microarray. Proc. Natl Acad. Sci. USA, 97, 91279132.
Tureci, O., Sahin, U., Zwick, C., Koslowski, M., Seitz, G. and Pfreundschuh, M. (1998) Identification of a meiosis-specific protein as a member of the class of cancer/testis antigens. Proc. Natl Acad. Sci. USA, 95, 52115216.
Watanabe, D., Yamada, K., Nishina, Y., Tajima, Y., Koshimizu, U., Nagata, A. and Nishimune, Y. (1994) Molecular cloning of a novel Ca(2+)-binding protein (calmegin) specifically expressed during male meiotic germ cell development. J. Biol. Chem., 269, 77447749.
Zhang, L.P., Stroud, J., Eddy, C.A., Walter, C.A. and McCarrey, J.R. (1999) Multiple elements influence transcriptional regulation from the human testis-specific PGK2 promoter in transgenic mice. Biol. Reprod., 60, 13291337.
Zinkham, W.H. (1972) A unique form of lactate dehydrogenase in human sperm: biological and clinical significance. Johns Hopkins Med. J., 130, 110.[Web of Science][Medline]
Submitted on October 26, 2001; resubmitted on December 13, 2001; accepted on March 4, 2002.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
L. Visser and S. Repping Unravelling the genetics of spermatogenic failure Reproduction, February 1, 2010; 139(2): 303 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kawashima, B. A.H. Osman, M. Takashima, A. Kikuchi, S. Kohchi, E. Satoh, M. Tamba, M. Matsuda, and N. Okamura CABS1 Is a Novel Calcium-Binding Protein Specifically Expressed in Elongate Spermatids of Mice Biol Reprod, June 1, 2009; 80(6): 1293 - 1304. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhou, D. Qin, A. Tang, D. Zhou, J. Qin, B. Yan, R. Diao, Z. Jiang, Z. Cai, and Y. Gui Developmental expression pattern of a novel gene, TSG23/Tsg23, suggests a role in spermatogenesis Mol. Hum. Reprod., April 1, 2009; 15(4): 223 - 230. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hu, J. Xing, L. Chen, X. Guo, Y. Du, C. Zhao, Y. Zhu, M. Lin, Z. Zhou, and J. Sha RGS22, A Novel Testis-Specific Regulator of G-protein Signaling Involved in Human and Mouse Spermiogenesis along with GNA12/13 Subunits Biol Reprod, December 1, 2008; 79(6): 1021 - 1029. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J I Ellis, R. A Furlong, S. J Conner, J. Kirkman-Brown, M. Afnan, C. Barratt, D. K Griffin, and N. A Affara Coordinated transcriptional regulation patterns associated with infertility phenotypes in men J. Med. Genet., August 1, 2007; 44(8): 498 - 508. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Feig, C. Kirchhoff, R. Ivell, O. Naether, W. Schulze, and A.-N. Spiess A new paradigm for profiling testicular gene expression during normal and disturbed human spermatogenesis Mol. Hum. Reprod., January 1, 2007; 13(1): 33 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. He, W.-Y. Chan, and M. Dym Microarray technology offers a novel tool for the diagnosis and identification of therapeutic targets for male infertility Reproduction, July 1, 2006; 132(1): 11 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
K Wagoner, G Sanchez, A-N Nguyen, G C Enders, and G Blanco Different expression and activity of the {alpha}1 and {alpha}4 isoforms of the Na,K-ATPase during rat male germ cell ontogeny Reproduction, November 1, 2005; 130(5): 627 - 641. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Huang, J. Li, L. Lu, M. Xu, J. Xiao, L. Yin, H. Zhu, Z. Zhou, and J. Sha Novel Development-Related Alternative Splices in Human Testis Identified by cDNA Microarrays J Androl, March 1, 2005; 26(2): 189 - 196. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhou, X. Ren, X. Huang, L. Lu, M. Xu, L. Yin, J. Li, and J. Sha SMYD3-NY, a Novel SMYD3 mRNA Transcript Variant, May Have a Role in Human Spermatogenesis Ann. Clin. Lab. Sci., January 1, 2005; 35(3): 270 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Huang, J. Zhang, L. Lu, L. Yin, M. Xu, Y. Wang, Z. Zhou, and J. Sha Cloning and expression of a novel CREB mRNA splice variant in human testis Reproduction, December 1, 2004; 128(6): 775 - 782. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yoshisue, S. M. Puddicombe, S. J. Wilson, H. M. Haitchi, R. M. Powell, D. I. Wilson, A. Pandit, A. E. Berger, D. E. Davies, S. T. Holgate, et al. Characterization of Ciliated Bronchial Epithelium 1, a Ciliated Cell-Associated Gene Induced During Mucociliary Differentiation Am. J. Respir. Cell Mol. Biol., November 1, 2004; 31(5): 491 - 500. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Huang, H. Wang, M. Xu, L. Lu, Z. Xu, J. Li, Z. Zhou, and J. Sha Expression of a Novel RAD23B mRNA Splice Variant in the Human Testis J Androl, May 1, 2004; 25(3): 363 - 368. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Schlecht, P. Demougin, R. Koch, L. Hermida, C. Wiederkehr, P. Descombes, C. Pineau, B. Jegou, and M. Primig Expression Profiling of Mammalian Male Meiosis and Gametogenesis Identifies Novel Candidate Genes for Roles in the Regulation of Fertility Mol. Biol. Cell, March 1, 2004; 15(3): 1031 - 1043. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Y. Pang, H. C. Taylor, W. Johnson, S. Alexander, Y. Chen, Y. A. Su, X. Li, N. Ravindranath, M. Dym, O. M. Rennert, et al. Identification of Differentially Expressed Genes in Mouse Spermatogenesis J Androl, November 1, 2003; 24(6): 899 - 911. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Schultz, F. K. Hamra, and D. L. Garbers A multitude of genes expressed solely in meiotic or postmeiotic spermatogenic cells offers a myriad of contraceptive targets PNAS, October 14, 2003; 100(21): 12201 - 12206. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xu, J. Xiao, J. Chen, J. Li, L. Yin, H. Zhu, Z. Zhou, and J. Sha Identification and characterization of a novel human testis-specific Golgi protein, NYD-SP12 Mol. Hum. Reprod., January 1, 2003; 9(1): 9 - 17. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Cheng, J. M. Li, J. Chen, Y. H. Ge, Z. R. Yu, D. S. Han, Z. M. Zhou, and J. H. Sha NYD-SP16, a Novel Gene Associated with Spermatogenesis of Human Testis Biol Reprod, January 1, 2003; 68(1): 190 - 198. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||













