Molecular Human Reproduction, Vol. 8, No. 8, 702-709,
August 2002
© 2002 European Society of Human Reproduction and Embryology
Testis and spermatogenesis |
Identification and characterization of the cynomolgus monkey chromodomain gene cynCDY, an orthologue of the human CDY gene family*
1 Institute of Reproductive Medicine of the University, Domagkstrasse 11, D-48149 Münster, and 2 Institute of Human Genetics and Anthropology, University of Freiburg, Breisacher Straße 33, 79106 Freiburg, Germany
| Abstract |
|---|
|
|
|---|
Microdeletions within the AZF (azoospermia factor) a, b and c regions of the Y chromosome can be detected worldwide in 110% of infertile men. AZFc, containing genes such as DAZ, CDY, RBMY and others, is most frequently deleted and associated with oligo- or azoospermia. The function of the different genes within AZFc is not yet understood. Here we report the identification and first characterization of the cynomolgus monkey (Macaca fascicularis) homologue of the human CDY gene. cynCDY encodes a 541 aa protein, which like human CDY possesses two putative functional domains: an N-terminal chromodomain, possibly involved in heterochromatin interactions, and a C-terminal domain showing similarity to enoyl-CoA-isomerase, which is involved in fatty acid oxidation. Northern analysis and in-situ hybridization experiments revealed testis- and stage-specific expression of cynCDY mRNA, mainly confined to round and elongating spermatids. Fluorescence in-situ hybridization (FISH) performed on monkey metaphase chromosomes displayed exclusively Y-specific signals in Yq12.1. Using fibre FISH, short signal stretches that indicate the presence of three CDY copies could be visualized, although their integrity or function remains unknown. cynCDY is similar to human CDY with features of a retrotransposon, but different in the 3'UTR. It seems to represent a more ancestral form of CDY and its characterization yields insights into the evolution of candidate genes for AZF.
AZF/azoospermia/CDY/microdeletions/Y chromosome
| Introduction |
|---|
|
|
|---|
Microdeletions of the Y chromosome have been described in 110% of patients with idiopathic male infertility and are associated with severely reduced sperm concentrations <5x106 sperm/ml (Hargreave, 2000
The drastic effects of an AZFc microdeletion on spermatogenesis imply that genes essential for spermatogenesis are located in this region of the Y chromosome. The most common type of AZFc deletion is large (3.5 Mb) and results in the complete loss of several testis-specific genes or gene families (Saut et al., 2000
; Kuroda-Kawaguchi et al., 2001
). The DAZ, RBMY, BPY2, PRY and CDY1 genes can be allocated within AZFc and each of them may be a candidate gene for AZF (Lahn and Page, 1997
; Hargreave, 2000
; Tilford et al., 2001
).
The gene content of AZFc has evolved by distinct molecular processes. In the case of the DAZ gene family, the entire genomic segment containing the autosomal DAZ homologue was duplicated and transposed to the Y chromosome, whereas in the case of CDY, a fully processed reverse-transcribed cDNA was integrated into a transcriptionally permissive locus on the Y chromosome. Amplification of both genes gave rise to the DAZ and CDY gene families and thus, transposition (DAZ), retroposition (CDY) and subsequent amplification represent mechanisms for gene building during evolution of the human Y chromosome (Glaser et al., 1998a
; Lahn and Page, 1999
; Lahn et al., 2001
). In the human, CDY evolved from the Y chromosomal retrotransposition of a transcript generated from the autosomal single copy CDYL (CDY-like) gene. Thereafter, CDY underwent gene duplications on the Y chromosome, giving rise to at least three CDY copies, two of them designated CDY1 (with a major and a minor splice variant), located in interval 6F on the long arm of the Y chromosome and one, designated CDY2, located in interval 5L. The CDY1 major transcript and CDY2 completely lack any intronic sequences, as one would expect from retrotransposons, while the CDY1 minor transcript has regained some intronic sequences, giving rise to a CDY gene reminiscent of exonintron structure. The CDY genes are expressed only in the testis, whereas the CDYL gene is ubiquitously expressed (Lahn and Page, 1999
; Saxena et al., 2000
).
The process of gene building on the Y chromosome occurred within the last 100 million years, making the DAZ and CDY gene families young genes in evolutionary terms. CDY and DAZ genes can be detected on Y chromosomes of New World monkeys (only CDY, not DAZ), Old World monkeys, great apes and humans, but are not present on the Y chromosome of non-primate species (Reijo et al., 1995
; Gromoll et al., 1999
; Lahn and Page, 1999
). Thus, classical animal models for the study of spermatogenesis, like rats and mice, completely lack the DAZ and CDY gene family. Therefore, functional studies of the expression of these genes or knock-out experiments are either not possible or can only be approached by knock-in strategies (Slee et al, 1999
). The divergent gene content on the Y chromosome of different species is scientifically challenging and requires more suitable animal models. The non-human primate, the cynomolgus monkey Macaca fascicularis, provides an animal model which is more closely related to the human than rats or mice with regard to genetic content and hormonal regulation of spermatogenesis.
In our attempt to characterize the genes from the AZFc region of the human in the monkey model, we have recently isolated and characterized the monkey homologue of the human DAZ gene family (Carani et al., 1997
; Gromoll et al., 1999
). In this report we describe a second candidate gene from the AZFc region, the monkey homologue of CDY, cynCDY.
| Materials and methods |
|---|
|
|
|---|
cDNA library screening
The monkey testis cDNA library was constructed using the oligo dT primed cDNA synthesis kit (Stratagene, Heidelberg, Germany) employing the Uni-ZAPXR unidirectional phagemid vector, in collaboration with the Institute of Hormone Research, Hamburg, Germany. Plating of recombinant phages, generation of replica filters and hybridization were performed according to standard protocols. Hybridization was carried out using the full length human CDY cDNA as a probe at 60°C for 1618 h. Filters were washed at a final stringency of 1x standard saline citrate (SSC)/0.1% sodium dodecyl sulphate (SDS) at 60°C and exposed for 12 days at 80°C using intensifying screens. Positive clones were purified by plaque isolation and two additional screening procedures. Phagemids were excised according to the manufacturer's protocol and the corresponding cDNAs sequenced from both directions.
Northern blot hybridization
Total RNA from human and cynomolgus monkey testis tissue was isolated by the Ultraspec method (Biotec, Houston, USA). RNA was precipitated with isopropanol at 4°C overnight, washed with 75% ethanol, dissolved in DEPC-treated water and the RNA concentration was determined photometrically. Electrophoresis of the samples, each lane containing 20 µg RNA, was performed on 1% agarose gel containing formaldehyde. The gel was blotted onto a nylon membrane (Amersham, Braunschweig, Germany) and fixed by cross-linking through UV irradiation. Filters were prehybridized at 68°C for 1 h in ExpressHyb (Clontech, Heidelberg, Germany) containing 0.1 mg/ml denatured salmon sperm DNA. Hybridization was performed for 2 h under the same conditions with addition of the [32P] dCTP labelled cDNA probe corresponding to the entire coding sequence of cynCDY (1.6 kb), to a final concentration of 1x106 cpm/ml. In addition, a ß-actin cDNA probe was used as loading control. The HighPrime kit (Boehringer, Mannheim, Germany) was used for labelling the probes. After hybridization, the filters were washed 4x for 10 min with continuous agitation in 2xSSC, 0.1% SDS at room temperature and 2x for 15 min in 0.1xSSC, 0.1% SDS at 60°C. Blots were exposed overnight to Phosphor-Screen imaging plates at 4°C and scanned using the Storm 860 Phosphorimager (Molecular Dynamics, USA).
In-situ hybridization
Java monkey testis tissue was bouin-fixed and embedded in paraffin using routine procedures. Sections of 5 µm thickness were mounted on Super Frost Plus slides (Langenbrinck, Emmendingen, Germany). After deparaffinization and rehydration, sections were treated according to a previously described procedure (Gromoll et al., 1997
) and prehybridized for 2 h at 37°C in 50 µl of hybridization buffer (50% formamid, 2xSSC, 1x Denhardt's, 250 µg/ml yeast tRNA and 125 µg/ml salmon sperm DNA) in a humid chamber. In-situ hybridizations were performed for 18 h at 37°C in 40 µl of hybridization buffer containing 10% dextran sulphate and 70100 ng DIG-labelled sense or antisense cRNA probe corresponding to the entire open reading frame (ORF) sequence of cynCDY. Probes were generated by an Sp6 or T7 RNA polymerase in-vitro transcription using a DIG-RNA labelling kit (Roche Diagnostics, France). After hybridization, sections were washed at 37°C in 2xSSC for 2x15 min, in 1xSSC for 2x15min, in buffer containing 20 µg/ml RNase A for 30 min, and in 0.1xSSC for 2x30 min. Hybridization signals were detected by incubation with an anti-DIG-AP antibody and subsequent staining with nitrobluetetrazolium chloride (NBT) 5-bromo-4-chloro-3-indoyl-phosphate (BCIP) substrate solution (Boehringer). Sections were counterstained with haematoxylin. After conventional mounting, tissue sections were examined by light microscopy. Images were taken with CCD AxioCam (Carl Zeiss Jena GmbH, Köln, Germany). Staging of the seminiferous tubules was performed corresponding to the 12-stage classification proposed by Clermont and Antar (Clermont and Antar, 1973
).
Southern blot hybridization
A total of 20 µg EcoRI digested DNA from female and male adult humans and monkeys was agarose gel electrophorized and blotted onto nylon membrane (Amersham). The hybridization conditions were identical to the Northern blot procedure, except for the hybridization and washing temperatures which were lower (60 and 50°C respectively). Exposure and scanning were as previously described.
PCR amplification
Genomic DNA was obtained from macaque and human peripheral leukocytes using the Nucleon Kit II (Scotlab, Wiesloch, Germany). PCR amplification of genomic DNA from cynCDY and human CDY1 minor form was performed using the oligonucleotide primers J130, CGTGTCTTTCCTCATGGCTTC (forward for both species); macaqueCDY-2r, CTTTACCATGGATTCGACCC (reverse for macaque); CDYa-exon2-2r, CATTCTGTGTCTTTCTGGGAGG (reverse for human and specific for CDY1 minor). The following products were obtained: a 1610 bp fragment from macaque DNA and a 2076 bp fragment from human DNA. PCR conditions were: 20 s at 94°C for initial denaturation, then 35 cycles of 20 s at 94°C, 30 s at 58°C, 2 min 30 s at 72°C, and then a final extension of 4 min at 72°C. The PCR products were run on a 1% agarose gel.
Fluorescence in-situ hybridization (FISH)
Chromosome preparation
Chromosome spreads for fluorescence in-situ hybridization (FISH) were prepared from PHA-stimulated peripheral blood lymphocytes taken from male cynomolgus monkeys (M. fascicularis) as previously described (Schempp et al., 1995
). Slide preparations were checked for well-spreading and plasma-free preparation of metaphase plates. Only slides from such batches judged as optimal metaphase preparations were considered for FISH, and were stored at 80°C until use.
Released chromatin preparation
Extended Y chromatin structures from interphase nuclei were generated according to previously published protocols (Fidlerova et al., 1994
).
FISH
Prior to FISH, the slides were treated with RNase followed by pepsin digestion as previously described (Ried et al., 1992
). FISH using genomic lambda clones for cynDAZ, corresponding to genomic region of exon 2 to exon 6 of the monkey cynDAZ gene, and the full length cynCDY cDNA on chromosome spreads of the cynomolgus monkey (M. fascicularis) essentially followed the methods as described (Schempp et al., 1995
). FISH of the full length cynCDY cDNA to released chromatin preparations was performed accordingly.
Fluorescence microscopy and imaging
Preparations were evaluated using a Zeiss Axiophot epifluorescence microscope equipped with single-bandpass filters for excitation of red, green and blue (Chroma Technologies). During exposures, only excitation filters were changed, allowing for pixelshift-free image recording. Images with high magnification and resolution were obtained using a black and white CCD camera (Photometrix, Kodak KAF 1400) connected to the Axiophot. Camera control and digital image acquisition involved the use of an Apple Macintosh Quadra 950 computer.
| Results |
|---|
|
|
|---|
The cyn (cynomolgus) CDY cDNA and the putative amino acid sequence derived
Screening of a monkey testis cDNA library using human CDY cDNA as a probe yielded several positive clones. Further analysis of these clones by DNA sequencing revealed that three out of four clones contained partial sequences with different 5' extensions, and that one clone contained a full length cDNA with 1879 nucleotides. Comparison of all four clones revealed complete sequence identity and high similarity to human CDY. The lack of clones displaying other CDY transcripts indicates that the cDNA identified is the predominantly expressed cynCDY isoform.
Inspection of the cynCDY cDNA (accession no. AJ314841) revealed that the ORF consists of 1627 nucleotides and is preceded 5' by 13 nucleotides and followed 3' by 229 nucleotides, excluding the poly A tail. No classical polyadenylization signal could be identified in the 3' region.
The putative amino acid sequence derived from the cynCDY cDNA displays a protein with 541 aa and a molecular mass of 60 kDa. The pI is 9.06 and there are no specific hydrophobic or hydrophilic domains within the protein detectable using the DNAsis software program.
cynCDY protein displays features of chromo- and catalytic domain
A protein domain search within the cynCDY amino acid sequence showed, as with human CDY, the presence of two putative domains. In the N-terminal region (covering aa 1 to 61), cynCDY displays similarities (from 69 to 38%) to proteins having a chromodomain which can be involved in interactions with heterochromatin sites (Ball et al., 1997
; Figure 1
). The homology is conserved over a range of different species and organisms. A second domain with similarity varying from 70 to 35% can be allocated to the C-terminal part of cynCDY (aa 246541). It displays motifs of a catalytic domain, with features corresponding to the enoyl-CoA isomerase enzyme (Jannsen et al., 1994). Both domains are connected by an intermediate region with no apparent identity.
|
Detailed amino acid sequence comparisons of cynCDY to the three human CDY isoforms and the autosomal homologue CDYL revealed closest identity to CDY2 with respect to amino acid number (541 aa in both genes) and amino acid sequence similarity (82%, Figure 2
|
cynCDY is present on the Y chromosome of the cynomolgus monkey as a retrotransposon
To investigate whether cynCDY is present as a retrotransposon on the monkey Y chromosome, similar to CDY in the human, primers located 5' and 3' of the cynCDY cDNA were used for PCR amplification using female and male monkey DNA. An amplicon could only be generated from genomic male monkey DNA and not from female monkey DNA, indicating the Y chromosomal localization (Figure 3
2.1 kb could be detected. This difference in the size of cDNA and genomic DNA is caused by the additional intron present in the human CDY1 (Lahn and Page, 1999
|
Expression analysis of cynCDY mRNA
Tissue-specific expression, transcript size and level of expression was investigated by hybridizing total RNA from cynomolgus (macaque) monkey, marmoset and human using a radioactively labelled 1.6 kb cDNA probe encompassing the whole ORF of cynCDY. A hybridization signal could only be detected in testicular tissues, but not in mouse testis and not in other monkey organs such as male liver and kidney or female uterus (Figure 4
2.4 kb, as calculated from the migration pattern of the corresponding 28S and 18S band, was visible. Densitometric analysis of the CDY signals obtained after normalization with ß-actin revealed a 3-fold and 5-fold higher expression in the cynomolgus monkey compared with the marmoset and human respectively. However, it is possible that the different expression levels could in part be affected by different hybridization kinetics when using a cynCDY probe (88% identical to human CDY). By in-situ hybridization on testis sections, cynCDY mRNA could be localized in round and early elongating spermatids (Figure 5A,B
|
|
Southern blot hybridization of cynCDY
Southern blot hybridization of female and male EcoRI digested genomic DNA from human and monkey was performed with 1.6 kb cDNA probe corresponding to the whole cynCDY coding sequence. Several bands were visible in female and male humans and monkeys (Figure 6
|
FISH and fibre-FISH analysis
The Y chromosomal location of DAZ and CDY genes in the cynomolgus monkey (M. fascicularis) was defined by applying multicolour FISH of cynomolgus-specific gene probes to metaphase chromosome spreads of this monkey. DAZ and CDY sequences were exclusively mapped in the proximal long arm region of the tiny acrocentric Y chromosome of the cynomolgus monkey (Figure 7
|
To determine the number of CDY genes on the cynomolgus monkey Y chromosome, we applied high-resolution FISH with a cynomolgus-specific CDY gene probe to extended interphase Y chromatin (fibre FISH). As shown in Figure 8
|
If one supposes a maximum release of DNA (1bp = 3.4 Å), the bar of 10 µm in Figure 8
70 kb. However, it should be noted that the `fibre FISH' technique applied here does not allow for an accurate length calibration of chromatin fibre. Thus an exact measurement in terms of fibre length per bp of DNA is not possible. | Discussion |
|---|
|
|
|---|
CDY belongs to a group of gene families which, like DAZ, RBMY and BPY, are putative candidate genes for AZFc. Unlike the RBMY genes, DAZ and CDY are phylogenetically young genes on the Y chromosome, and are present only in primates and humans. Only indirect evidence is currently available concerning their role in spermatogenesis. In most cases, the deletion of each of the genes within AZFc leads to severe spermatogenic failure, resulting in oligo- or azoospermia.
Evolutionary aspects of cynCDY
CDY evolved from an initial retrotransposition of the fully processed transcript of the autosomal CDYL gene into an ancient form of the Y chromosome and is present in simian primates, including apes, Old World and New World monkeys. Thus the retrotransposition event must have occurred
4050 million years ago in the simian lineage after its divergence from prosimians, but before the split between Old and New World monkeys (Sassaman et al., 1997
; Lahn and Page, 1999
). CDY persisted on the Y chromosome throughout evolution and underwent further changes and amplifications.
FISH experiments on monkey chromosomes revealed only one positive signal for cynCDY within the proximal long arm of the Y chromosome. To determine the accurate gene copy number, fibre FISH was performed and three distinct signals, corresponding to three gene copies, on the cynomolgus Y chromosome could be distinguished. However, there is no evidence that all of them are functional. Screening of the monkey testis cDNA library gave no hints that the different copies can correspond to different gene forms, which might indicate the presence of only one type or only one functional copy of CDY on the monkey Y chromosome.
Homology plots revealed that cynCDY shows closest similarity to CDY2, but this is not significantly different from CDY1. Thus, it is difficult to estimate the features of the ancient form which was first retrotransposed to the Y chromosome. Inspection of the 3'UTR of human CDY and cynCDY genes provides interesting details. In CDY2 and CDY1 major transcripts polyadenylation occurs close to or directly after the stop codon and polyadenylation signals can be identified within the ORF, e.g. the polyadenylation signal AATAAA in CDY2 is located just 15 nucleotides before the translational stop codon. Such signals cannot be observed in the corresponding autosomal CDYL gene, thus these sites must have arisen after retrotransposition through mutations that generated appropriate signal sequences (Lahn and Page, 1999
). Nucleotide sequence comparison of cynCDY with CDY2 revealed that the internal polyadenylation motif present in the human is not present in the monkey (AATCAA instead of AATAAA). This might be the reason that cynCDY is polyadenylated further downstream, although classical sites for polyadenylation could not be identified. Furthermore, cynCDY still possesses a relatively large 3'UTR with 229 nucleotides. Comparison of the 3'UTR in the human CDYL and the monkey cynCDY revealed high identity with 62% when compared with 35% similarity between CDYL and CDY1 minor transcript. The different polyadenylation patterns between human and monkey CDY favours a model in which the ancient form of the retrotransposed CDY had a 3' UTR containing a polyadenylation site which, with the introduction of mutations during evolution, led to the CDY transcripts currently seen.
The chromo- and catalytic domains of the CDY genes
Similarities between human and monkey CDY in the chromo and catalytic domains are surprisingly high when compared with 82% overall amino acid identity. In the case of the chromodomain this value reaches 97%. This implies that the domains of the CDY genes lie under some evolutionary constraints, indicative of a functioning protein.
Proteins containing a chromodomain such as cynCDY are generally believed to be involved in an interaction with heterochromatin sites to mediate gene silencing (Ball et al., 1997
; Bannister et al., 2001
). Concerning the catalytic domain, sequence identities are not as evident as they are for the chromodomain. The catalytic domain of cynCDY shows a pattern homologous to a key enzyme in mitochondrial ß-oxidation of unsaturated fatty acids, enoyl-CoA isomerase. By amino acid comparisons of the autosomal mouse and human CDYL genes it becomes clear that the catalytic domain is highly conserved (99%), indicating a crucial function of this domain.
cynCDY mRNA expression
Northern blot experiments revealed testis-specific cynCDY mRNA expression and transcription levels significantly higher than in the human testis. Even the expression of CDY mRNA in another primate species, the marmoset monkey (Callithrix jacchus), seems to be higher than in the human. These differences might be due to some kind of gene silencing in the human, possibly induced by additional mutations in putative regulatory regions of the promoter or by new mutations, which could effect turnover of the human CDY mRNA. However, it is also possible that the observed differences in the expression levels are in part affected by different hybridization kinetics, given that we used a cynCDY probe. Further studies on the regulation and onset of expression should clarify the differences observed in CDY expression.
Maximum cynCDY mRNA expression was detectable by in-situ hybridization during the advanced stages of spermatogenesis in round and elongating spermatids. This expression pattern may not necessarily coincide with the translation of cynCDY protein, which could appear in later stages. Interestingly, for most AZF genes expression starts with the first mitotic or meiotic events during spermatogenesis. cynDAZ/DAZ has been shown to be expressed in gonocytes, B spermatogonia and spermatocytes; grossly similar expression also including round spermatids has been shown for RBMY (Elliott et al., 1998
; Gromoll et al., 1999
; Reijo et al., 2000
; Warchol et al., 2001
).
In a recent publication by Kleiman et al. CDY1 expression was investigated in biopsies from infertile men using RTPCR (Kleiman et al., 2001
). CDY1 expression was detected in all biopsies in which spermatids and/or spermatozoa were observed by histological analysis, while it was lacking in men with meiosis maturation arrest and SCO syndrome. These results are consistent with our findings on cynCDY mRNA expression. Thus, cynCDY and its human homologues might be late onset genes and could play a role during spermiogenesis.
Conclusions
In summary, the isolation and characterization of the monkey cynCDY homologue of the human CDY gene family yields insights into the evolution of Y chromosomal genes. It demonstrates that three CDY gene copies, without proof of function, are present in the cynomolgus monkey, similar to the human where at least three copies have been distinguished so far. Further rearrangement events of the CDY genes have probably occurred only in the human. This is in agreement with the recently cloned cynomolgus monkey DAZ gene where a more ancient form could be found. Delineation of the expression patterns during spermatogenesis and characterization of conserved domains within the CDYs of human and monkey should now enable functional studies, e.g. interaction of CDY with heterochromatic sites, to prove that this gene is functional and might be a candidate gene for AZF.
| Acknowledgements |
|---|
|
|
|---|
The authors thank Professor E.Nieschlag for continuous support of the project. K.Niermann and E.Pekel are thanked for excellent technical assistance. B.Hitschfeld and Dr B.Dworniczak, Institute of Human Genetics, University of Münster are thanked for their help with Southern blots. The initial support in identifying cynCDY by Dr David C.Page and Dr Bruce Lahn, Whitehead Institute, Cambridge, MA, USA, is acknowledged. Dr Helen Skaletsky, Whitehead Institute, has contributed to the sequence analysis. Susan Nieschlag M.A. and Dr Trevor Cooper are acknowledged for language editing of the manuscript. Professor Dr N.Michiels is thanked for supporting this work which forms part of the doctoral thesis by E.K. The authors also thank the Fritz-Thyssen Stiftung (Az 1078) and IMF (GR 229813) for financing this study.
| Notes |
|---|
3 To whom correspondence should be addressed. E-mail. gromolj{at}uni-muenster.de
* Data deposition: The sequence reported in this paper has been deposited in the GenBank database (accession no.: AJ314841). ![]()
| References |
|---|
|
|
|---|
Ball, L.J., Murzina, N.V., Broadhurst, R.W., Raine, A.R., Archer, S.J., Stott, F.J., Murzin, A.G., Singh, P.B., Domaille, P.J. and Laue, E.D. (1997) Structure of the chromatin binding (chromo) domain from mouse modifier protein 1. EMBO J., 16, 24732481.[Web of Science][Medline]
Bannister, A.J., Zegerman, P., Partridge, J.F., Miska, E.A., Thomas, J.O., Allshire, R.C. and Kouzarides, T. (2001) Selective recognition of methylated lysine 9 on histone H3 by HP1 chromo domain. Nature, 410, 120124.[Medline]
Carani, C., Gromoll, J., Simoni, M., Weinbauer, G.F. and Nieschlag, E. (1997) cynDAZLA: a cynomolgus monkey homologue of the human autosomal DAZ gene. Mol. Hum. Reprod., 3, 479483.
Clermont, Y. and Antar, M. (1973) Duration of the cycle of the seminiferous epithelium and the spermatogonial renewal in the monkey Macaca arctoides. Am. J. Anat., 136, 153166.[Web of Science][Medline]
Elliott, D.J., Oghene, K., Makarov, G., Makarova, O., Hargreave, T.B., Chandley, A.C., Eperon, I.C. and Cooke, H.J. (1998) Dynamic changes in the subnuclear organisation of pre-mRNA splicing proteins and RBM during human germ cell development. J. Cell Science, 111, 12551265.[Abstract]
Fidlerova, H., Senger, G., Kost, M., Sanseau, P. and Sheer, D. (1994) Two simple procedures for releasing chromatin from routinely fixed cells for fluorescence in situ hybridization. Cytogen. Cell Genet., 65, 203205.[Web of Science][Medline]
Glaser, B., Yen, P.H. and Schempp W. (1998a) Fibre-fluorescence in situ hybridization unravels apparently seven DAZ genes or pseudogenes clustered within a Y-chromosome region frequently deleted in azoospermic males. Chrom. Res., 6, 481486.[Medline]
Glaser, B., Grutzner, F., Willmann, U., Stanyon, R., Arnold, N., Taylor, K., Rietschel, W., Zeitler, S., Toder, R. and Schempp, W. (1998b) Simian Y chromsomes: species-specific rearrangements of DAZ, RBM, and TSPY versus contiguity of PAR and SRY. Mamm. Genome, 9, 226231.[Web of Science][Medline]
Gromoll, J., Wessels, J., Rosiepen, G., Brinkworth, M.H. and Weinbauer, G.F. (1997) Expression of mitotic cyclin B1 is not confined to proliferating cells in the rat testis. Biol. Reprod., 57, 13121319.[Abstract]
Gromoll, J., Simoni, M., Weinbauer, G.F. and Nieschlag, E. (1998) Spermatogenesis-specific genes deleted in infertile men. In Stefanini, M. (ed.) Testicular Function: From Gene Expression to Genetic Manipulation. Springer Verlag, Heidelberg, Germany, pp. 273294.
Gromoll, J., Weinbauer, G.F., Skaletsky, H., Schlatt, S., Rocchietti-March, M., Page, D.C. and Nieschlag, E. (1999) The Old World monkey DAZ (Deleted in AZoospermia) gene yields insights into the evolution of the DAZ gene cluster on the human Y chromosome. Hum. Mol. Genet., 11, 20172024.
Hargreave, T.B. (2000) Genetic basis of male fertility. Br. Med. Bulletin, 56, 650671.
Janssen, U., Fink, T., Lichter, P. and Stoffel, W. (1994) Human mitochondrial 3,2-trans-enoyl-CoA isomerase (DCI): gene structure and localization to chromosome 16p13.3. Genomics, 23, 223238.[Web of Science][Medline]
Kleiman, S.E., Lagziel, A., Yogev, L., Botchan, A., Paz, G. and Yavetz, H. (2001) Expression of CDY1 may identify complete spermatogenesis. Fertil. Steril., 75, 166173.[Web of Science][Medline]
Kostova, E. and Gromoll, J. (2001) The DAZ gene family and its role in spermatogenesisclinical and experimental aspects. Andrologia, 33, 239240.
Krausz, C., Quintana-Murci, L., Barbaux, S., Siffroi, J.P., Rouba, H., Delafontaine, D., Souleyreau-Therville, N., Arvis, G., Antoine, J.M., Erdei, E. et al. (1999) A high frequency of Y chromosome deletions in males with nonidiopathic infertility. J. Clin. Endocrinol. Metab., 84, 36063612.
Kuroda-Kawaguchi, T., Skaletsky, H., Brown, L.G., Minx, P.J., Cordum, H.S., Waterston, R.H., Wilson, R.K., Silber, S., Oates, R., Rozen, S. et al. (2001) The AZFc region of the Y chromosome features massive palindromes and uniform recurrent deletions in infertile men. Nature Genet., 29, 279286.[Web of Science][Medline]
Lahn, B.T. and Page, D.C. (1997) Functional coherence of the human Y chromosome. Science, 278, 675680.
Lahn, B.T. and Page, D.C. (1999) Retroposition of autosomal mRNA yielded testis-specific gene family on human Y chromosome. Nature Genet., 21, 429433.[Web of Science][Medline]
Lahn, B.T., Pearson, N.M. and Jegalian, K. (2001) The human Y chromosome, in the light of evolution. Nat. Rev. Genet., 2, 207216.[Web of Science][Medline]
Maurer, B., Gromoll, J., Simoni, M., and Nieschlag, E. (2001) Prevalence of Y chromosome microdeletions in infertile men who consulted a tertiary care medical centre: the Münster experience. Andrologia, 33, 2733.[Web of Science][Medline]
Reijo, R., Lee, T.Y., Salo, P., Alagappan, R., Brown, L.G., Rosenberg, M., Rozen, S., Jaffe, T., Straus, D., Hovatta, O. et al. (1995) Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nature Genet., 10, 383393.[Web of Science][Medline]
Reijo, R.A., Dorfman, D.M., Slee, R., Renshaw, A.A., Loughlin, K.R., Cooke, H. and Page, D.C. (2000) DAZ family proteins exist throughout male germ cell development and transit from nucleus to cytoplasm at meiosis in humans and mice. Biol. Reprod., 63, 14901496.
Ried, T., Baldini, A., Rand, T.C., and Ward, D.C. (1992) Simultaneous visualization of seven different DNA probes by in situ hybridization using combinatorial fluorescence and digital imaging microscopy. Proc. Natl Acad. Sci. USA, 89, 13881392.
Sassaman, D.M., Dombroski, B.A., Moran, J.V., Kimberland, M.L., Naas, T.P., DeBerardinis, R.J., Gabriel, A., Swergold, G.D. and Kazazian, H.H. Jr (1997) Many human L1 elements are capable of retrotransposition. Nature Genet., 16, 3743.[Web of Science][Medline]
Saut, N., Terriou, P., Navarro, A., Levy, N. and Mitchell, M.J. (2000) The human Y chromosome genes BPY2, CDY1 and DAZ are not essential for sustained fertility. Mol. Hum. Reprod., 6, 789793.
Saxena, R., de Vries, J.W., Repping, S., Alagappan, R.K., Skaletsky, H., Brown, L.G., Ma, P., Chen, E., Hoovers, J.M. and Page, D.C. (2000) Four DAZ genes in two clusters found in the AZFc region of the human Y chromosome. Genomics, 67, 256267.[Web of Science][Medline]
Schempp, W., Binkele, A., Arnemann, J., Glaser, B., Ma, K., Taylor, K., Toder, R., Wolfe, J., Zeitler, S. and Chandley, A.C. (1995) Comparative mapping of YRRM- and TSPY-related cosmids in man and hominoid apes. Chromosome Res., 3, 227234.[Web of Science][Medline]
Simoni, M. (2001) Molecular diagnosis of Y chromsome microdeletions in Europe: state-of-the-art and quality control. Hum. Reprod., 16, 402409.
Slee, R., Grimes, B., Speed, R.M., Taggart, M., Maguire, S.M., Ross, A., McGill, N.I., Saunders, P.T. and Cooke, H.J. (1999) A human DAZ transgene confers partial rescue of the mouse Dazl null phenotype. Proc. Natl Acad. Sci. USA, 96, 80408045.
Tilford, C.A., Kuroda-Kawaguchi, T., Skaletsky, H., Rozen, S., Brown, L.G., Rosenberg, M., McPherson, J.D., Wylie, K., Sekhon, M., Kucaba T.A. et al. (2001) A physical map of the human Y chromosome. Nature, 409, 943945.[Medline]
Vogt, P. (1998) Human chromosome deletions in Yq11, AZF candidate genes and male infertility: history and update. Mol. Hum. Reprod., 4, 739744.
Warchol, J.B., Augustyniak, S., Stecewicz, D., and Jankowska, A. (2001) Detection of DAZ mRNA distribution in human testis using reverse transcription in situ PCR technique (RTISPCR). Folia Histochem. Cytobiol., 39, 117118.[Medline]
Submitted on July 24, 2001; resubmitted on February 7, 2002; accepted on May 8, 2002.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







