Molecular Human Reproduction, Vol. 8, No. 8, 776-784,
August 2002
© 2002 European Society of Human Reproduction and Embryology
Implantation and pregnancy |
Detection of HLA-G by a specific sandwich ELISA using monoclonal antibodies G233 and 56B
1 Department of Pharmacology, NV Organon, 5342 CC Oss, 2 Departments of Bloodtransfusion and Transplantation Immunology and 3 Gynaecology and Obstetrics, University Medical Centre Nijmegen, Nijmegen, The Netherlands and 4 Research Group in Human Reproductive Immunobiology, Department of Pathology, University of Cambridge, Cambridge, UK
To whom correspondence should be addressed at: NV Organon, Department of Pharmacology, Room RE 3201, P.O.Box 20, 5340 BH Oss, The Netherlands. E-mail: marie-jose.vanlierop{at}organon.com
| Abstract |
|---|
|
|
|---|
Human leukocyte antigen (HLA)-G, which is mainly expressed at the maternalfetal interface, may play a role in the immune tolerance of the semi-allogenic fetus by the mother. Functional studies have shown that HLA-G is indeed a potential modulator of different immune responses. Therefore, it is of interest to study the level of expression of soluble HLA-G in several biological fluids derived from women with and without fertility problems. In order to measure soluble HLA-G, a reliable and sensitive HLA-G specific sandwich ELISA is required. Here, we describe such an ELISA in which G233 is used as the coating antibody and 56B as the detecting antibody. In comparison with two other assays, this assay shows highest responses to recombinant HLA-G and native HLA-G in primary trophoblast culture supernatant and high responses to HLA-G in amniotic fluid. No HLA-G in follicular fluid or preimplantation embryo culture supernatant could be detected.
56B/BFL.1/ELISA/G233/HLA-G
| Introduction |
|---|
|
|
|---|
The non-classical major histocompatibility complex (MHC) class I molecule, human leukocyte antigen (HLA)-G, has gained a lot of interest in reproductive immunology because of its predominant expression in trophoblast cells. HLA-G differs from other MHC class I molecules by its low polymorphism, truncated cytoplasmic tail and the existence of seven splice variants (Geraghty et al., 1987
The restricted expression of HLA-G at the maternalfetal interface suggests that it may play a major role in the immune tolerance of the semi-allogenic fetus by the mother. Functional studies have shown that HLA-G is a potential modulator of different immune responses. It has the capacity to function as a restriction element for mouse CD8+ cytotoxic T cells (Horuzsko et al., 1997
). HLA-G has also been shown to form a ligand for several killer inhibitory receptors present on natural killer cells, myelomonocytic cells and/or T cell subsets (Cantoni et al., 1998
; Navarro et al., 1999
; Pazmany et al., 1999
). Through these receptors HLA-G might be able to modulate cytotoxicity, cytokine production and proliferation, as has been shown in vitro (Maejima et al., 1997
; Riteau et al., 1999
; Bainbridge et al., 2000b
; Kapasi et al., 2000
). Furthermore, in-vitro studies with soluble HLA-G have shown induction of apoptosis of blast-like cells (Fournel et al., 2000a
), an effect on the release of cytokines from peripheral blood mononuclear cells (Kanai et al., 2001
) and inhibition of proliferative allo-responses (Lila et al., 2001
).
If HLA-G is indeed essential for successful embryo implantation and early pregnancy, it is of interest to study the level of expression of soluble HLA-G in several biological fluids derived from women with and without fertility problems. In order to measure soluble HLA-G, different groups have reported the use of ELISA techniques using different monoclonal antibodies. However, for most of these antibodies cross-reactivity with other HLA molecules can not completely be excluded. Alternatively, when no HLA-G specific antibodies were available, indirect methods, including immunodepletions, have been used (Athanassakis et al., 1999
; Fournel et al., 1999
; Puppo et al., 1999
; Rebmann et al., 1999
). A study has been described in which different sandwich ELISA methods to detect soluble HLA-G were compared (Fournel et al., 2000b
). However, the well characterized, highly HLA-G specific antibody G233 (Loke et al., 1997
) was not used in this study. Here, we describe a reliable and sensitive HLA-G specific sandwich ELISA in which G233 is used as the coating antibody and 56B as the detecting antibody. In comparison with two other assays, this assay shows highest responses to recombinant HLA-G and native HLA-G in primary trophoblast culture supernatant and high responses to HLA-G in amniotic fluid. No HLA-G in follicular fluid or preimplantation embryo culture supernatant could be detected. A different assay, in which BFL.1 is used as the detecting antibody, shows a response in amniotic fluid only. Furthermore, when testing a large number of amniotic fluids by this assay and by the combination of G233 and 56B-biotin, the outcomes do not correspond.
| Materials and methods |
|---|
|
|
|---|
Monoclonal antibodies
G233 (IgG2a,
) is an HLA-G specific antibody generated by immunization of HLA-A2.1/human ß2m double transgenic mice with murine L-cells transfected with both human ß2m and HLA-G (Loke et al., 1997
Generation of 56B
Antibody 56B was generated by immunization of Balb/c mice with a peptide corresponding to amino acids 138158 of the
2 domain of HLA-G coupled to keyhole limpet haemocyanin. The
2 domain of HLA-G (TAAQISKRKCEAANVAEQRRA) represents a region of very low homology to other HLA class I molecules and within the structure of HLA-G it is well accessible for antibody binding. Mice were immunized with 100 µg of the peptide in Complete Freunds Adjuvant s.c.; booster-immunizations were given 3 and 6 weeks later with 50 µg peptide in Incomplete Freunds Adjuvant and a final booster was given i.p. with 50 µg peptide without adjuvant. The mouse with the highest serum antibody titre against the same peptide coupled to bovine serum albumin (BSA) was selected. Four days after the last booster, splenocytes from the selected mouse were isolated and fused with NS.1 myeloma cells by electrofusion. Cells were cultured in selection medium containing hypoxanthine/thymidine (Sigma). After 8 days supernatants from all growing hybridomas were tested for their reactivity on BSA-coupled peptide by ELISA. Reactive supernatants were then tested for their reactivity on several cell lines by FACS analysis. The following cell lines were used: JEG-3 and BeWo (both choriocarcinoma cell lines expressing HLA-G); LCL721.221 (HLA-null lymphoblastoid cell line), K562 (erythroleukaemia cell line) and their HLA-G1 transfectants, LCL721.221-G1 and K562-G1; IM9 and 293T (respectively a lymphoma and fibroblast cell line expressing HLA-A, -B and -C). Hybridomas positive on all HLA-G expressing cell lines and negative on all HLA-G null cell lines were selected. These hybridomas were subcloned by limiting dilution. The clone with the best reactivity pattern, 56B, was isotyped as IgG2b,
(shown by IsoStripTM; Boehringer Mannheim).
Characterization of 56B
56B recognized the denatured heavy chain from HLA-G derived from 1% CHAPS lysates of K562-G1, LCL721.221-G1 and JEG-3 cells on a Western blot (Figure 1
). The parental cell lines (K562 and LCL721.221) and IM9 cells (not shown) were used as negative controls (Figure 1
). On this Western blot, other proteins besides HLA-G also seem to be stained by 56B, indicating a broader specificity of this antibody. In contrast to W6/32 (anti HLA-class I/ß2m), 56B did not immunoprecipitate HLA-G from lysates of these HLA-G expressing cells that were membrane surface biotinylated. Using a 56B-coupled column, we were able to purify recombinant HLA-G from cell culture supernatant. Furthermore, 56B was found to stain all populations of trophoblast cells in both acetone-fixed frozen sections and formalin-fixed paraffin sections of first trimester human placenta (Figure 2
). Since HLA-G is known to be expressed specifically on extravillous trophoblasts, 56B seems to again recognize more than HLA-G alone on these placental sections.
|
|
Amniotic and follicular fluid, embryo and trophoblast culture supernatant
Amniotic fluid was collected from standard transabdominal amniocentesis on indication of maternal age. Villous material and cellular components were spun down and the supernatant was collected in low protein binding tubes (MiniSorpTM; Nunc, Wiesbaden, Germany) and stored at 80°C until use. One pool containing equal amounts of 10 different amniotic fluids was used as a standard reference in the sandwich ELISA.
For the isolation of trophoblast cells, first trimester (612 weeks gestation) placental tissue was obtained from vaginal termination of pregnancy and processed immediately, according to the method described previously (Burrows et al., 1993
). Trophoblast cells were pooled from three to four placentae. These cultures routinely contain 1090% trophoblast cells with characteristics of extravillous trophoblast, being HLA-G positive (King et al., 2000
). Supernatants were collected from these trophoblasts cultured for 14 days in human tubal fluid (HTF) medium without serum in 24-well plates at a concentration of 2x106 cells per well (106/ml).
Follicular fluid was obtained from follicles punctured during an IVF protocol. Fluid from each follicle was collected separately in a low protein binding tube and after removal of the oocyte, the fluid was centrifuged and the supernatant was collected and frozen at 80°C until use.
Embryo culture supernatants (ECS) were derived from fresh or cryopreserved embryos generated at IVF procedures. In the case of fresh embryos, embryos were cultured separately in 10 µl medium (HTF plus 10% pasteurized plasma solution) under a drop of oil, after removal of medium containing sperm cells the day after fertilization. ECS was collected at day 3 or 5 of culture. In the case of cryopreserved embryos (frozen at day 3 of culture), thawed embryos were cultured for another 3 or 5 days in 10 µl of medium (HTF plus 15% GPO) under oil, and the medium was collected at these time points.
Recombinant soluble HLA-G
For the generation of recombinant soluble HLA-G, a construct for a single chain product containing all extracellular domains (
1,
2 and
3) of HLA-G, an HLA-G binding peptide (RLPKDFVDL) and ß2M, coupled to each other by linkers, was made in a few steps. An overview of the different steps is shown in Figure 3
.
|
First we cloned the HLA-G specific fragment by PCR on a placental clone using HLA-G specific primers (sense primer: ATGGTGGTCATGGCACCCCGAACC and antisense primer: TGAGACAGAGACGGAGACAT) followed by a second PCR using primers: GAACTGATCAGGAGGAGGAGGCTCCCACTCCATGAGGTATTTC (sense) and CAGAGGATCCTCC-TCCTCCTGATCCTATTCCTCCCCATCTCAGCATGAGGGGCTGGGG (antisense), both including part of a linker and an enzyme restriction site that allowed easy cloning of this fragment. Besides these two PCRs, a PCR was performed on a ß2M clone (Image clone 909866) to obtain the ß2M fragment again using primers that included enzyme restriction sites and (for the sense primer) part of the linker sequence: GAGGAGGATCCGGAGGAGGCGGTTCTATCCAGCGTACTCCAAAGATTCAGG (sense) and TGAAGGTACCTTACATGTCTCGATCCCACTTAAC (antisense). The front part of the construct, consisting of the leader peptide, the HLA-G binding peptide and a linker, was generated by annealing eight overlapping oligonucleotides (of which the first and last again contained enzyme restriction sites). All three resulting fragments were ligated into one large fragment which was cloned into the pNGV1 expression vector (in-house generated vector). Chinese hamster ovary (CHO) cells were transfected with this vector and those cells expressing HLA-G were selected by staining the cell culture supernatant in a Western blot with HCA2 (kindly provided by Dr H.Ploegh, Boston, USA). One positive clone was selected for a large scale production and the recombinant soluble HLA-G was purified in two steps: first by ion exchange chromatography using a Q-sepharose column (Streamline Q XL, pH 8.0) with 0.8 mol/l sodium chloride as elution buffer and secondly by immunoaffinity chromatography using a 56B-coupled N-hydroxysuccinimide-sepharose column with 0.1 mol/l glycine, pH 2.7 as elution buffer. The final eluate was neutralized and desalted. Concentration and purity of the recombinant protein was determined by densitometry from a Commassie Brilliant Blue stained protein gel containing both the recombinant protein as well as a protein standard range. Purity of the recombinant product was 85%, and the concentration was 8.4 µg/ml. The recombinant protein (with a size of 48 kDa) and degradation products were specifically stained by 56B on a Western blot (see Figure 4
|
Sandwich ELISA
Microtitre plates (96-well; Greiner) were coated with different monoclonal antibodies at the indicated concentrations in 0.1 mol/l carbonate buffer pH 9.0 (Pierce, Rockford, USA) overnight at 4°C. Plates were blocked with phosphate-buffered saline (PBS) containing 0.05% Tween 20 (PBSTween) and 5% skim milk (Difco, Detroit, USA) for 2 h at room temperature. After four washes with PBSTween, the samples (50 µl/well diluted in PBS) were added (if possible in duplicate) and incubated for 2 h at room temperature and overnight at 4°C. The different detecting biotinylated antibodies (at the indicated concentrations, diluted in PBSTween with 0.5% skim milk) were added to the wells after four washes with PBSTween and incubated again overnight at 4°C. Plates were washed four times with PBSTween and incubated with VECTASTAIN Elite ABC reagent (Vector Laboratories, Burlingame, USA) for 1 h at room temperature. Finally, plates were washed four times with PBSTween and four times with demineralized water and incubated with substrate (3,3',5,5'-tetramethylbenzidine/ureum hydrogen peroxide; Organon Teknica, Boxtel, The Netherlands) for 30 min at room temperature in the dark. The reaction was stopped by addition of 2N H2SO4. Absorbance was measured at 450 nm in an Anthos EIA-reader 2001 Labotec (Zymark Lab Automation, Breda, The Netherlands).
Statistical analysis
A correlation study between the results of two assays (the ELISA method using W6/32 and BFL.1-biotin in comparison with the ELISA method using G233 and 56B-biotin) was performed by a Pearson correlation analysis. This statistical test compares pairs of results and calculates a correlation coefficient (r) for the paired values. Results are positively correlated when r > 0.7 with a P-value < 0.05 (confidence interval of >95%).
| Results |
|---|
|
|
|---|
Development of an HLA-G specific ELISA
Nine combinations of antibodies were tested in a sandwich ELISA using amniotic fluid (containing HLA-G) as an antigenic sample. The resulting responses of three combinations all using BFL.1-biotin as the detecting antibody are shown in Figure 5A
|
From these three assays, the combination of 56B as the capturing mAb and biotinylated BFL.1 as the detecting mAb showed the highest response on amniotic fluid (OD450 of 2.7). However, since it is not known what type of HLA-G is being recognized by BFL.1, six other combinations of antibodies, excluding the use of BFL.1, were also tested, the responses of which are shown in Figure 5B
From these six assays, the combinations with 56B-biotin as the detecting antibody (W6/32/56B-biotin and G233/56B-biotin) appeared to result in the highest responses to amniotic fluid (OD450 values of 0.72 and 0.63 respectively).
To confirm the HLA-G specificity of the three selected ELISA methods (56B/BFL.1-biotin, G233/56B-biotin and W6/32/56B-biotin), culture supernatants of EpsteinBarr virus transformed B cell lines expressing HLA-A, -B and -C but no HLA-G and culture supernatants of cell lines without any expression of HLA (CHO cells) were tested. No responses were found towards these samples (data not shown).
Detection of HLA-G in different samples
As shown above, using the three ELISA methods we were able to detect HLA-G in amniotic fluid. However, whether all three ELISA methods recognize the same form(s) of HLA-G possibly present in amniotic fluid (shed membrane-bound HLA-G1 or HLA-G2, soluble HLA-G5 or HLA-G6 or maybe other still unknown forms of HLA-G) is not clear. For this reason all three selected ELISA methods were used to test the presence of HLA-G in samples from additional sources: recombinant soluble HLA-G, primary trophoblast culture supernatant, follicular fluid and preimplantation embryo culture supernatant.
Recombinant soluble HLA-G
First a concentration range of a purified recombinant soluble HLA-G1 product was tested. This product was not detected by the 56B/BFL.1-biotin sandwich ELISA. In contrast, the W6/32/56B-biotin assay and the G233/56B-biotin assay both showed a dose-dependent response to the recombinant HLA-G product (Figure 6
). The G233/56B-biotin assay was clearly much more sensitive for the detection of recombinant soluble HLA-G (lowest detection level ~1 ng/ml) than the W6/32/56B-biotin assay (lowest detection level ~100 ng/ml). Thus, it appears that the most sensitive ELISA for measuring HLA-G in a form similar to the recombinant HLA-G product is formed by G233 in combination with 56B-biotin. As can be seen in Figure 6
, the amount of HLA-G to be measured by this assay ranges from 1120 ng/ml. According to the OD450 values seen with the dose-range of this recombinant soluble HLA-G standard, the OD450 value of amniotic fluid, measured by G233/56B-biotin (0.63), corresponds to an HLA-G concentration of ~20 ng/ml.
|
Trophoblast culture supernatant
Secondly, we investigated whether extravillous trophoblasts from first trimester human placentae would produce a soluble form of HLA-G which could be detected by one or more of the three HLA-G specific ELISA methods. For this purpose, supernatants from in-vitro cultured primary trophoblasts (1.3x106 cells/ml) were collected at day 1, 3 or 4 of the culture. Supernatants derived from four or five different trophoblast cultures, collected at the same time, were pooled and an aliquot was concentrated five times. The concentrated, non-concentrated and diluted samples were tested. Results are shown in Figure 7
|
Follicular fluid
Follicular fluids, collected from punctured follicles during an IVF protocol, were tested to assess whether one or more forms of soluble HLA-G would already be present in the fluid surrounding the oocyte. Selection of the follicular fluids tested was based on the quality of the oocytes derived from these fluids, as explained in the legend of Figure 8
|
Embryo culture supernatants
To investigate whether a soluble form of HLA-G is already produced by the preimplantation embryo, we collected supernatants of in-vitro cultured embryos from couples participating in an IVF programme. For this purpose, embryos at different developmental stages (8-cell stage, blastocyst stage or beyond blastocyst stage) or with different morphological scores (good blastocysts or embryos with arrested growth) were selected. The embryos were cultured singly in 10 µl of medium, supernatants of selected groups were pooled and, when possible, divided into three equal parts to be tested in all three sandwich ELISA methods. None of the ELISA methods detected any HLA-G in supernatants from fresh 8-cell stage embryos (data not shown). No HLA-G could be detected in supernatants from blastocysts (Figure 9A
|
Summary
In summary, the G233/56B-biotin ELISA appears to be the only assay that recognizes HLA-G not only as a recombinant protein, but also in its form present in amniotic fluid and produced and secreted by primary trophoblast cells. Therefore, this assay is preferred over others in the detection of HLA-G in body fluids as well as in cell culture supernatants.
Comparison of two ELISA methods for the detection of HLA-G in different amniotic fluid samples
Since the combination of the HLA-G specific antibody BFL.1 with the pan-HLA class I antibody W6/32 has frequently been used to detect HLA-G in amniotic fluids (Fournel et al., 1999
; Puppo et al., 1999
), we wondered whether the outcome of responses of several amniotic fluid samples when using the assay including BFL.1 and W6/32 could be compared with the outcome when using the G233/56B-biotin assay. Since we obtained only very low or no responses to amniotic fluid when coating was performed with BFL.1 and detection with W6/32-biotine, we chose to use W6/32 as the coating antibody and BFL.1-biotine as the detecting antibody.
The W6/32/BFL.1-biotin ELISA and the G233/56B-biotin ELISA were used to test 20 separate amniotic fluid samples. Figure 10
shows a scattergram of the normalized OD values (values are relative to the mean OD of all 20 samples which is set at 1) of both assays. As can be seen in this figure, no significant correlation between the two types of measurements could be found: Pearson correlation revealed r of 0.21 and a P-value of 0.36.
|
| Discussion |
|---|
|
|
|---|
Different ELISA methods to detect soluble forms of HLA-G in biological fluids or cell culture supernatants have been described by several groups during the last 4 years. Due to uncertainties about the precise specificity of the antibodies used and the forms of secreted HLA-G, different results and conclusions have been obtained (Athanassakis et al., 1999
Here we describe the use of three new sandwich ELISA methods including the well characterized, highly HLA-G specific, monoclonal antibody G233, together with a new monoclonal antibody to HLA-G, 56B. Using this ELISA, we show the presence of HLA-G in amniotic fluid and 1 day trophoblast culture supernatant, whereas no HLA-G could be found in follicular fluids or preimplantation embryo culture supernatants of IVF patients. The latter finding is in contrast with the results published by Jurisicova et al. who demonstrated expression of HLA-G by most preimplantation embryos (Jurisicova et al., 1996
). This difference cannot easily be explained. Possibly, the anti-HLA-G antibody they used (1B8) had a different pattern of specificity.
When a comparison is made between the G233/56B-biotin ELISA and the two other ELISA methods described in this paper, the G233/56-biotin ELISA seems to be most sensitive for detection of HLA-G in a recombinant or native form. One exception is the detection of HLA-G in amniotic fluid. In this case the use of BFL.1 (in combination with 56B or W6/32) seems to respond much better. However, the BFL.1-based ELISA does not seem to recognize recombinant HLA-G or HLA-G derived from primary cultures of trophoblasts. Furthermore, comparison of the responses with a set of amniotic fluids derived from different individuals measured by the combination of W6/32/BFL.1-biotin and G233/56B-biotin, revealed substantial differences. The only possible explanation for these differences is again a difference in specificity of the different antibodies. G233 has clearly been shown to detect full length HLA-G1, also recognized by 56B raised against an HLA-G specific peptide from the
2 domain. Although BFL.1 is also raised against the full length HLA-G1 (Bensussan et al., 1995
), we were not able to confirm its specificity, either by the ELISA methods or by other methods such as FACS analyses, immunoprecipitations or Western blotting of HLA-G1 positive cell lines (data not shown). Although some groups have reported clear HLA-G specificity of BFL.1 (Wagner et al., 2000
), others have also reported problems using BFL.1 (Blaschitz et al., 2000
; Paul et al., 2000b
). Maybe BFL.1 recognizes another separate form of HLA-G only found to be present in amniotic fluid. Since combination of BFL.1 with W6/32 as well as with 56B recognizes this putative particular form of HLA-G in amniotic fluid, this form must be associated with ß2m and must contain an HLA-G
2 domain. However, so far, the only known isoforms of HLA-G that fulfil these characteristics are HLA-G1 and HLA-G5.
In conclusion, the sandwich ELISA using the combination of G233 as the coating mAb and 56B as the detecting mAb forms a reliable and sensitive assay for detection of HLA-G in both biological fluids and cell culture supernatants. This assay should preferably be used for (soluble) HLA-G specific analyses.
| Acknowledgements |
|---|
|
|
|---|
We would like to thank Professor Dr B.Fauser and colleagues from the Academical Hospital Rotterdam for providing us with fresh blastocyst culture supernatants.
| References |
|---|
|
|
|---|
Athanassakis, I., Paflis, M. and Vassiliadis, S. (1999) Detection of soluble HLA-G levels in maternal serum can be predictive for a successful pregnancy. Transplantation, 31, 18341837.
Bainbridge, D.R.J., Ellis, S.A. and Sargant, I.L. (2000a) The short forms of HLA-G are unlikely to play a role in pregnancy because they are not expressed at the cell surface. J. Reprod. Immunol., 47, 116.[Web of Science][Medline]
Bainbridge, D.R.J., Ellis, S.A. and Sargant, I.L. (2000b) HLA-G suppresses proliferation of CD4+ T-lymphocytes. J. Reprod. Immunol., 47, 1726.[Web of Science][Medline]
Barnstable, C.J., Bodmer, W.F., Brown, G., Galfre, G., Milstein, C., Williams, A.F. and Ziegler, A. (1978) Production of monoclonal antibodies to group A erythrocytes, HLA and other human cell surface antigensnew tools for genetic analysis. Cell, 14, 920.[Web of Science][Medline]
Bensussan, A., Mansur, I.G., Mallet, V., Rodriguez, A.M., Girr, M., Weiss, E.H., Brem, G., Boumsell, L., Gluckman, E., Dausset, J. et al. (1995) Detection of membrane-bound HLA-G translated products with a specific monoclonal antibody. Proc. Natl Acad. Sci. USA, 92, 1029210296.
Blaschitz, A., Hutter, H., Leitner, V., Pilz, S., Wintersteiger, R., Dohr, G. and Sedlmayr, P. (2000) Reaction patterns of monoclonal antibodies to HLA-G in human tissues and on cell lines: a comparative study. Hum. Immunol., 61, 10741085.[Web of Science][Medline]
Burrows, T., King, A. and Loke, Y.W. (1993) Expression of integrins by human trophoblast and differential adhesion to laminin and fibronectin. Hum. Reprod., 8, 475484.
Cantoni, C., Verdiani, S., Falco, M., Pessino, A., Cilli, M., Conte, R., Pende, D., Ponte, M., Mikaelsson, M.S., Moretta, L. et al. (1998) p49, a putative HLA class I-specific inhibitory NK receptor belonging to the immunoglobulin superfamily. Eur. J. Immunol., 28, 19801990.[Web of Science][Medline]
Fournel, S., Aguerre-Girr, M., Campan, A., Salauze, L., Berrebi, A., Lone, Y.-C., Lenfant, F. and Le Bouteiller, P. (1999) Soluble HLA-G: Purification from eukaryotic transfected cells and detection by a specific ELISA. Am. J. Reprod. Immunol., 42, 2229.
Fournel, S., Aguerre-Girr, M., Huc, X., Lenfant, F., Alam, A., Toubert, A., Bensussan, A. and Le Bouteiller, P. (2000a) Cutting edge: Soluble HLA-G1 triggers CD95/CD95 ligand-mediated apoptosis in activated CD8+ cells by interacting with CD8. J. Immunol., 164, 61006104.
Fournel, S., Huc, X., Solier, C., Legros, M., Praud-Brethenou, C., Moussa, M., Chaouat, G., Berrebi, A., Bensussan, A., Lenfant, F. et al. (2000b) Comparative reactivity of different HLA-G monoclonal antibodies to soluble HLA-G molecules. Tissue Antigens, 55, 510518.[Web of Science][Medline]
Fujii, T., Ishitani, A. and Geraghty, D.E. (1994) A soluble form of the HLA-G antigen is encoded by a messenger ribonucleic acid containing intron 4. J. Immunol., 153, 55165524.[Abstract]
Geraghty, D.E., Koller, B.H. and Orr, H.T. (1987) A human major histocompatibility complex class I gene that encodes a protein with a shortened cytoplasmic segment. Proc. Natl Acad. Sci. USA, 84, 91459149.
Hamai, Y., Fujii, T., Miki, A., Geraghty, D.E., Harada, I., Takai, Y., Kozuma, S., Tsutsumi, O. and Taketani, Y. (1999) Quantitative assessment of human leukocyte antigen-G protein in amniotic fluid by a double-determinant enzyme-linked immunosorbent assay using anti-human leukocyte antigen-G-specific antibody `87G'. Am. J. Reprod. Immunol., 41, 293295.
Horuzsko, A., Antoniou, J., Tomlinson, P., Portik-Dobos, V. and Mellor, A.L. (1997) HLA-G functions as a restriction element and a transplantation antigen in mice. Int. Immunol., 9, 645653.
Hunt, J.S., Jadhav, L., Chu, W., Geraghty, D.E. and Ober, C. (2000) Soluble HLA-G circulates in maternal blood during pregnancy. Am. J. Obstet. Gynecol., 183, 682688.[Web of Science][Medline]
Ishitani, A. and Geraghty, D.E. (1992) Alternative splicing of HLA-G transcripts yields proteins with primary structures resembling both class I and class II antigens. Proc. Natl Acad. Sci. USA, 89, 39473951.
Jurisicova, A., Casper, R.F., MacLusky, N.J., Mills, G.B. and Librach, C.L. (1996) HLA-G expression during preimplantation human embryo development. Proc. Natl Acad. Sci. USA, 93, 161165.
Kanai, T., Fujii, T., Kozuma, S., Yamashita, T., Miki, A., Kikuchi, A. and Taketani, Y. (2001) Soluble HLA-G influences the release of cytokines from allogenic peripheral blood mononuclear cells in culture. Mol. Hum. Reprod., 7, 195200.
Kapasi, K., Albert, S.E., Yie, S.-M., Zavazava, N. and Librach, C.L. (2000) HLA-G has a concentration-dependent effect on the generation of an allo-CTL response. Immunology, 101, 191200.[Web of Science][Medline]
King, A., Burrows, T.D., Hiby, S.E., Bowen, J.M., Joseph, S., Verma, S., Lim, P.B., Gardner, L., Le Bouteiller, P., Ziegler, A. et al. (2000) Surface expression of HLA-C antigen by human extravillous trophoblast. Placenta, 21, 376387.[Web of Science][Medline]
Kirszenbaum, M., Moreau, P., Gluckman, E., Dausset, J. and Carosella, E.D. (1994) An alternatively spliced form of HLA-G mRNA in human trophoblasts and evidence for the presence of HLA-G transcript in adult lymphocytes. Proc. Natl Acad. Sci. USA, 91, 42094213.
Lila, N., Rouas-Freiss, N., Dausset, J., Carpentier, A. and Carosella, E.D. (2001) Soluble HLA-G protein secreted by allo-specific CD4+ T cells suppresses the allo-proliferative response: a CD4+ T cell regulatory mechanism. Proc. Natl Acad. Sci. USA, 98, 1215012158.
Loke, Y.W., King, A., Burrows, T., Gardner, L., Bowen, M., Hiby, S., Howlett, S., Holmes, N. and Jacobs, D. (1997) Evaluation of trophoblast HLA-G antigen with a specific monoclonal antibody. Tissue Antigens, 50, 135146.[Web of Science][Medline]
Maejima, M., Fujii, T., Kozuma, S., Okai, T., Shibata, Y. and Taketani, Y. (1997) Presence of HLA-G expressing cells modulates the ability of peripheral blood mononuclear cells to release cytokines. Am. J. Reprod. Immunol., 38, 7982.
Mallet, V., Proll, J., Solier, C., Aguerre-Girr, M., DeRossi, M., Loke, Y.W., Lefant, F. and Le Bouteiller, P. (2000) The full length HLA-G1 and no other alternative form of HLA-G is expressed at the cell surface of transfected cells. Hum. Immunol., 61, 212224.[Web of Science][Medline]
Navarro, F., Llano, M., Bellon, T., Colonna, M., Geraghty, D.E. and Lopez-Botet, M. (1999) The ILT2(LIR1) and CD94/NKG2A NK cell receptors respectively recognize HLA-G1 and HLA-E molecules co-expressed on target cells. Eur. J. Immunol., 29, 277283.[Web of Science][Medline]
Paul, P., Cabestre, F.A., Ibrahim, E.C., Lefebvre, S., Khalil-Daher, I., Vazeux, G., Moya Quiles, R.M., Bermond, F., Dausset, J. and Carosella, E.D. (2000a) Identification of HLA-G7 as a new splice variant of the HLA-G mRNA and expression of soluble HLA-G5, -G6 and -G7 transcripts in human transfected cells. Hum. Immunol., 61, 11381149.[Web of Science][Medline]
Paul, P., Rouas-Freiss, N., Moreau, P., Cabestre, F.A., Menier, C., Khalil-Daher, I., Pangault, C., Onno, M., Fauchet, R., Martinez-Laso, J. et al. (2000b) HLA-G, -E, -F preworkshop: tools and protocols for analysis of non-classical class I genes transcription and protein expression. Hum. Immunol., 61, 11771195.[Web of Science][Medline]
Pazmany, L., Mandelboim, O., Vales-Gomez, M., Davis, D.M., Becker, T.C., Reyburn, H.T., Seebach, J.D., Hill, J.A. and Strominger, J.L. (1999) Human leukocyte antigen-G and its recognition by natural killer cells. J. Reprod. Immunol., 43, 127137.[Web of Science][Medline]
Puppo, F., Costa, M., Contini, P., Brenci, S., Cevasco, E., Ghio, M., Norelli, R., Bensussan, A., Capitanio, G.L. and Indiveri, F. (1999) Determination of soluble HLA-G and HLA-A, -B, and -C molecules in pregnancy. Transplantation, 31, 18411843.
Rebmann, V., Pfeiffer, K., Påßler, M., Ferrone, S., Maier, S., Weiss, E. and Grosse-Wilde, H. (1999) Detection of soluble HLA-G molecules in plasma and amniotic fluid. Tissue Antigens, 53, 1422.[Web of Science][Medline]
Riteau, B., Menier, C., Khalil-Daher, I., Sedlik, C., Dausset, J., Rouas-Freiss, N. and Carosella, E.D. (1999) HLA-G inhibits the allogenic proliferative response. J. Reprod. Immunol., 43, 203211.[Web of Science][Medline]
Riteau, B., Rouas-Freiss, N., Menier, C., Paul, P., Dausset, J. and Carosella, E.D. (2001) HLA-G2, -G3, and -G4 isoforms expressed as nonmature cell surface glycoproteins inhibit NK and antigen-specific CTL cytolysis. J. Immunol., 166, 50185026.
Wagner, S.N., Rebmann, V., Willers, C.P., Grosse-Wilde, H. and Goos, M. (2000) Expression analysis of classic and non-classic HLA molecules before interferon alfa-2b treatment of melanoma. Lancet, 356, 220221.[Web of Science][Medline]
Submitted on December 19, 2001; accepted on April 30, 2002.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
V. R. Shaikly, I. E. G. Morrison, M. Taranissi, C. V. Noble, A. D. Withey, R. J. Cherry, S. M. Blois, and N. Fernandez Analysis of HLA-G in Maternal Plasma, Follicular Fluid, and Preimplantation Embryos Reveal an Asymmetric Pattern of Expression J. Immunol., March 15, 2008; 180(6): 4330 - 4337. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. van der Meer, H.G.M. Lukassen, B. van Cranenbroek, E.H. Weiss, D.D.M. Braat, M.J. van Lierop, and I. Joosten Soluble HLA-G promotes Th1-type cytokine production by cytokine-activated uterine and peripheral natural killer cells Mol. Hum. Reprod., February 1, 2007; 13(2): 123 - 133. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. V. F. Hviid HLA-G in human reproduction: aspects of genetics, function and pregnancy complications Hum. Reprod. Update, May 1, 2006; 12(3): 209 - 232. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Q. Yao, D. H. Barlow, and I. L. Sargent Differential Expression of Alternatively Spliced Transcripts of HLA-G in Human Preimplantation Embryos and Inner Cell Masses J. Immunol., December 15, 2005; 175(12): 8379 - 8385. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Blaschitz, H. Juch, A. Volz, H. Hutter, C. Daxboeck, G. Desoye, and G. Dohr The soluble pool of HLA-G produced by human trophoblasts does not include detectable levels of the intron 4-containing HLA-G5 and HLA-G6 isoforms Mol. Hum. Reprod., October 1, 2005; 11(10): 699 - 710. [Abstract] [Full Text] [PDF] |
||||
![]() |
I.L. Sargent Does 'soluble' HLA-G really exist? Another twist to the tale Mol. Hum. Reprod., October 1, 2005; 11(10): 695 - 698. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. LeMaoult, N. Rouas-Freiss, and E. D. Carosella HLA-G5 expression by trophoblast cells: the facts Mol. Hum. Reprod., October 1, 2005; 11(10): 719 - 722. [Full Text] [PDF] |
||||
![]() |
A. van der Meer, H.G.M. Lukassen, M.J.C. van Lierop, F. Wijnands, S. Mosselman, D.D.M. Braat, and I. Joosten Membrane-bound HLA-G activates proliferation and interferon-{gamma} production by uterine natural killer cells Mol. Hum. Reprod., March 1, 2004; 10(3): 189 - 195. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Fair, A. Gutierrez-Adan, M. Murphy, D. Rizos, F. Martin, M. P. Boland, and P. Lonergan Search for the Bovine Homolog of the Murine Ped Gene and Characterization of Its Messenger RNA Expression During Bovine Preimplantation Development Biol Reprod, February 1, 2004; 70(2): 488 - 494. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

















