Molecular Human Reproduction, Vol. 8, No. 9, 797-804,
September 2002
© 2002 European Society of Human Reproduction and Embryology
Testis and spermatogenesis |
Partial rescue of the Dazl knockout mouse by the human DAZL gene
MRC Human Genetics Unit, Western General Hospital, Crewe Rd, Edinburgh EH4 2XU, UK
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionAcknowledgementsReferences |
|---|
Y-chromosomal DAZ (deleted in azoospermia) and autosomal DAZ-like (DAZL) comprise a gene family involved in gametogenesis. Y-chromosomal and autosomal genes only co-exist in humans and old world monkeys, indicating that DAZ genes are a recent acquisition of the Y chromosome. In most mammals, the ancestral Dazl alone is sufficient to complete gametogenesis. It is not yet understood why humans and old world monkeys have a second set of genes that are apparently necessary for spermatogenesis, since deletions removing the Y-chromosomal DAZ are often associated with azoo- or oligospermia. We used transgenic mice carrying either human DAZL or human DAZ on a mouse Dazl null background to investigate the functions of the human homologues. Both transgenes enabled prophase spermatocytes to be produced, mainly of the leptonema/zygonema stage, but failed to promote differentiation into mid- to late pachytenes. The presence of human DAZL resulted in a larger amount of early germ cells compared with that observed in DAZ. The degree of rescue was independent of copy number, integration site or presence of the DAZ repeat region for the DAZ transgenes. These findings confirm that DAZL and DAZ can only substitute for early functions of the murine homologue resulting in the establishment of the germ cell population and partial progression into meiosis.
azoospermia/DAZ/DAZL/gametogenesis/Y chromosome
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionAcknowledgementsReferences |
|---|
The DAZ (deleted in azoospermia) and DAZ-like (DAZL) gene family is thought to be involved in germ cell differentiation. DAZ comprises multiple genes on the Y chromosome and is only present in humans and old world monkeys (Reijo et al., 1995
). In contrast, its single copy autosomal ancestor, DAZL, is highly conserved during evolution and has been isolated from humans, monkeys, rodents, flies, frogs, fish and worms (Cooke et al., 1996; Eberhardt et al., 1996; Saxena et al., 1996; Karashima et al., 1997; Houston et al., 1998; Maegawa et al., 1999). In man, where DAZ and DAZL co-exist, both genes share a high homology of up to 90% identical amino acids and a domain responsible for RNA binding (Saxena et al., 1996). A striking characteristic of the Y-chromosomal DAZ genes is the intragenic amplification and partial degeneration of exons 7 and 8 giving rise to a protein domain referred to as ‘DAZ repeat’ (Saxena et al., 1996). Sequence and structural heterogeneity of isolated cDNAs in this region indicates that multiple Y-chromosomal DAZ genes are transcribed (Yen et al., 1997). It has been shown that a subset of infertile human male patients have deletions in the region of the Y chromosome, AZFc, assigned to the DAZ gene family (Vogt et al., 1996). The resulting phenotype of the Y-chromosomal deletion is characterized by maturation arrest of germ cells and, in severe cases, Sertoli cell-only syndrome. Several observations have questioned the role of the DAZ gene family: (i) in some cases an AZFc phenotype is present although the DAZ genes are unaffected (Vereb et al., 1997); (ii) the deletions include other genes (Wong et al., 1999); and (iii) father to son transmission of DAZ deletions has been reported (Chang et al., 1999). The examination of homologues in animal models can contribute to our understanding of the functions of this gene family. Targeted disruption of Dazl expression in the mouse results in complete sterility of both sexes in animals homozygous for the null allele due to failure in germ cell maintenance and maturation (Ruggiu et al., 1997). The homologues of Xenopus and zebrafish are expressed in the germplasm of both sexes and RNAi ablation of Xdazl function causes failure of germ cell proliferation and migration (Houston et al., 1998; Maegawa et al., 1999; Houston and King, 2000).
Functional aspects have been addressed using mice transgenic for a human-derived DAZ gene that were crossed on the Dazl null background (Slee et al., 1999). Male progeny of the yS12 transgenic line show partial and variable rescue of the severe depletion of germ cells characteristic for the homozygous null phenotype. Fertility is not restored by the transgene and completion of spermatogenesis was never observed. This suggests that at least one DAZ gene used in their studies is functional, though to a limited extent compared with the mouse Dazl homologue.
However, during the generation of the yS12 transgenic line used by Slee and co-workers, the YAC-DNA used was mutated by rearrangement resulting in the loss of DAZ exon 1 and the promoter region (Slee et al., 1999). The partial rescue of the Dazl knockout phenotype observed in these mice could be due to this rearrangement. Partial rescue could also reflect functional divergence between Y-chromosomal and autosomal genes. In this study we aim to test the hypothesis that a human autosomal DAZL transgene would be a complete substitute for mouse Dazl. To complete the analysis we also included a DAZ transgene in our study. This important control was necessary to address the following questions arising from recent results. (i) Was the partial rescue observed by Slee et al. (Slee et al., 1999) a consequence of the 5' rearrangement and would a transgene, containing an intact promoter region, substitute completely for the loss of murine Dazl? (ii) The yS12 line contains a single integrated transgene, while DAZ genes are present in multiple copies on the Y chromosomes. Is an efficient function of DAZ therefore dependent on the expression of more than one (trans)gene? (iii) Are structural and sequence variations that discriminate DAZ genes from their autosomal DAZL homologues responsible for partial substitution of DAZ for mouse Dazl?
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionAcknowledgementsReferences |
|---|
Generation and genotyping of transgenic mice
Human DAZ PAC clone 201K10 was isolated from the RPCI1 library (UK HGMP Resource Centre) by filter hybridization in 7% sodium dodecyl sulphate (SDS)/0.5 mol/l sodium phosphate, pH 7.2, at 65°C with a PCR-generated 1 kb DAZ-specific probe from intron 1 (primers DAZint1: GTCGACAACAAAGCAGGAACCCTCC; DAZint2 GTCGACATCATAATTACGTATGC). Human DAZL PAC clone 174N13 was isolated from the RPCI-6 library generated from female DNA (Roswell Park Cancer Institute, Buffalo, USA) by filter hybridization as above using a 600 bp PCR-generated fragment (primers J816: AACAGACAAGAGACAACTGTC; Dazlex4-1: GTCGACTTTTCCATAGATGGATGAAACCG) spanning exons 4–11 of mouse Dazl cDNA. PAC DNA was isolated over EtBr gradients according to standard protocols, dialysed against 10 mmol/l Tris, 0.1 mmol/l EDTA, pH7.4 and injected into pronuclei at 2 ng/µl. G0 mice were F2 hybrids from crosses of C57BLxCBA/Ca F1 females and DazlTm1Hgu/+ males (Ruggiu et al., 1997
) and were backcrossed to DazlTm1Hgu/+ animals to establish transgenic lines. Eight alleles with an inserted human DAZ transgene were generated: TgN(hDAZp1)165Hgu (hereafter referred to as A165'), TgN(hDAZp1) 166Hgu (‘A166’), TgN(hDAZp1)166.1Hgu (‘A166.1’), TgN(hDAZp1) 170Hgu (‘A170’), TgN(hDAZp1)172.1Hgu (‘A172.1’), TgN(hDAZp1) 173Hgu (‘A173’), TgN(hDAZp1)173.1Hgu (‘A173.1’) and TgN(hDAZp1) 173.2Hgu (‘A173.2’). One line of TgN(hDAZLp1)174Hgu (‘A174') was generated carrying human DAZL. DazlTm1Hgu/+;TgN individuals were mated to test for phenotypic rescue in DazlTm1Hgu/DazlTm1Hgu;TgN offspring. Genotypes were determined by PCR as described (Ruggiu et al., 1997) and with human DAZ/DAZL primers [DAZ(L)int5 (GATCAACTTTCACTTGATGCC); DAZ(L)ex1 (CCAAAGGACGTGGCTGCAC)].
Histological methods
Mouse testes were processed as previously described (Slee et al., 1999). Immunohistochemistry for GCNA1 (Enders and May, 1994) and Dazl (Ruggiu et al., 2000) was performed as previously reported (Elliott et al., 1997) and positive cells were visualized using ABC complexes or the Envision+ System Peroxidase kit (Dako).
Testes were harvested for analyses at different time points for each transgenic line, ranging from 44 to 128 days.
Preparation of spermatocytes for electron microscopy
Electron microscope preparations were made by a dry-down microspreading method (Speed and Chandley, 1990). Grids were silver stained and examined with a Phillips CM10.
Southern and Western blot, RT–PCR, DOP–PCR
Nucleic acids were transferred on nylon filters and hybridizations were carried out using PCR-generated probes in 7% SDS/0.5 mol/l sodium phosphate, pH 7.2, at 65°C. Primers used for probe amplifications were: DAZ intron 10 (DAZint3: GTCGACGTGGCACATGTATTTTGGGC; DAZint4: GTCGACCACATTCTCTTCCGCTTCACC); 201K10Sp6end (Sp6nested: GATCCTCCCGAATTGACT AGTG; DAZSp6end: CATTACTCCAAATAAGTTGAGG); DAZ repeat (DAZrepfor: CAGGTCAGGTCA TCACTGG; DAZex8: AGATTTCTCCTTTGCTCCCC); DAZL [DAZ(L)ex6: GTGCAGCCACGTCCTTT GG; DAZLex7: CCAGTGATGACCTGAACTGG]; DAZL3'end (DAZLint10f: CAGAGTGGGTTTTACCTGGC; DAZLex11-2r: ATTCAAAACCAGCAACTTCCC).
Western blotting was performed on PVDF membranes according to standard protocols. Anti-Dazl antibody (Chang et al., 1999; Slee et al., 1999) was used for detection with ECL at 1:400 dilution.
cDNAs were generated from 5 µg total testis RNA using a pre-amplification kit (Gibco) with the specific primer DAZ(L)10-1rev (ATTAAACAGACAAGATACCACC) for DAZ expression studies, and oligo dT primer for DAZL respectively. Primers used for cDNA amplification and not described so far were: DAZ 5' UTRfor (GCCTGCGCTCCTCAGCC), DAZ 5' UTRrev (AGGATTTGCAGCAGACATGG), DAZ1, DAZ3 and DAZ4 (Slee et al., 1999).
DOP–PCR was carried out as described (Wu et al., 1996; Herring et al., 1998) using primer Sp6 remote and Sp6 nested, 6MW and R609 (AGGAAACAGCTAGACCATGGDGCHC).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionAcknowledgementsReferences |
|---|
Introduction and characterization of transgenes
Two PAC clones, 174N13 and 235D24, containing the human DAZL gene were isolated from the RPCI-6 library. PCR and Southern hybridization (Figure 1
) revealed that both PACs were positive for human DAZL sequences spanning from exon 1–11. The ends of the inserts were determined by DOP–PCR and did not contain any known sequences. We therefore considered PAC 174N13 to comprise an intact DAZL gene.
|
Four different DAZ-positive genomic clones, 201K10, 92A2, 91C2 and 91D2, were identified by screening the RPM1 library. Using Southern blot hybridization only 201K10 proved to contain a complete 5' end, but this also indicated that the 3' end of 201K10 was incomplete (data not shown). The 3' end of the 201K10 insert was determined by PCR and subsequent sequencing to be a BamHI site 2411 bp in intron 10 (position 34294 of reference sequence ac000021.em_hum1). Since the open reading frame of DAZ genes ends in the preceding exon 10 and no other clone identified contained an entire DAZ gene, 201K10 was considered to be a sufficient candidate clone for the generation of transgenic mice. To determine the 5' end of the 201K10 insert, DOP–PCR was applied (data not shown). Sequences of amplified fragments were homologous to a region starting 1625 bp upstream of exon 1, but in an inverted orientation. This sequence arrangement was thought to reflect the presence of a 5' end of a second DAZ gene orientated in a head-to-head manner. A corresponding organization of DAZ genes has been reported to be present on human Y chromosomes (Gläser et al., 1998
). To test this hypothesis, Southern hybridization was performed on XbaI-digested DNA with part of the duplicated fragment as probes. The probes did not contain any XbaI sites. One hybridization experiment is shown in Figure 2, lower left panel. Two fragments were obtained, one of the expected size of 5.5 kb originating from one DAZ gene and one larger band. The latter contained the duplicated fragment and the entire vector sequence of pCYPAC2 (Ioannou et al., 1994), which is devoid of any XbaI sites. As illustrated in Figure 2, the clone 201K10 contained two potential promoter elements.
|
The PAC 201K10 was only positive for DAZ-specific sequence tagged site (STS) markers; all flanking STSs tested, including CDY, PRY, TTY2 and BPY2 (Lahn and Page, 1997
), were negative (data not shown).
Using pronuclear injection to generate transgenic mice, one line was established for human DAZL and eight different mouse lines for human DAZ. Fluorescence in-situ hybridization was used to characterize the integration site of the transgenes. Hybridization results were also used to estimate copy number (Table I), and these were confirmed using quantitative Southern blots (data not shown). To assess integrity of the transgenes, Southern blots were probed with sequences from different locations within the DAZL and DAZ genes (Figures 1 and 2
). The probes used for DAZ and DAZL hybridization experiments detect corresponding fragments in the PACs and in DNA from transgenic animals. For human DAZL, Southern hybridization to DNA from the human cell line HT1080 revealed the presence of same banding pattern as from transgenic mice carrying the human DAZL gene. No signal was obtained from the DNA of a wild-type mouse, excluding the possibility of cross-hybridization to sequences from the endogenous Dazl locus. Taken together, these results indicate the structural integrity of the DAZL transgene (Figure 1). Most of the DAZ lines contained all the sequences that were tested, except lines A166 and A166.1. A166 only contained the region corresponding to the DAZ repeat, whereas this region was almost entirely deleted in A166.1 (Figure 2, third panel). In both lines, the duplicated 5' region was not detected by the probe used (Figure 2, first panel). Since DNA was present on the filters, as confirmed by ethidium bromide staining (not shown), both lines lack this duplicated region.
|
Striking heterogeneity among all lines was observed when probed with fragments covering the DAZ repeat region (Figure 2
, third panel). Only one line, A173.2, revealed the same pattern of restriction fragments as obtained from the input DNA, 201K10. All other lines exhibited a distinct banding pattern not shared by any other line. Incomplete digestion of the DNA seems unlikely to be the reason for this divergence, since the result was reproduced in two independent experiments. This heterogeneity might reflect a genetic predisposition to rearrangement or instability in this repeat region. Line A174 was used to assess the complementation capacity of human DAZL for the mouse Dazl gene. To address the questions of promoter and copy number influence on the DAZ-dependent rescue of the Dazl null phenotype, we focused on lines A173 and A170 for further characterization. The internal deletion of the DAZ repeat region manifest in line A166.1 gave us the opportunity to study whether the presence of this region of structural divergence is necessary for DAZ functioning.
Expression of transgenes
Expression of the human transgenes was investigated in males with a DazlTm1Hgu/DazlTm1Hgu;TgN genotype. The human transgenes were therefore the only source of DAZL/DAZ expression signals.
Transcription of the transgenes in the testis was initially studied by RT–PCR (Figure 3). Human DAZL mRNA tested positive using three different, human-specific primer pairs spanning the entire coding region from exons 1–10 as well as part of the 3' untranslated region (UTR). Transcription of the Y-chromosomal DAZ transgenes was assessed spanning the 5' UTR as well as the entire coding region (exons 1–10). The presence of at least seven repeat units was shown using a primer located in the DAZ repeat region (exon 7). No amplification was obtained using A166.1 cDNA as template, confirming the deletion of the DAZ repeat.
|
Amplification with primers spanning the DAZ repeat generated multiple products when cDNA derived from lines A170 and A173, with more than one integrated transgene, was used as template. A single product was obtained from various lines with only one integrated transgene (data not shown). This finding indicated that more than one copy of the DAZ transgene was expressed in the lines A170 and A173. Size heterogeneity of amplification products reflected genetic rearrangement of the DAZ repeat during integration into the mouse genome. Sufficient amounts of human DAZL and DAZ transcripts were present in the testes of transgenic animals to be also detectable on Northern blots (data not shown).
Translation of human DAZL messages could be examined as the mouse Dazl-specific antiserum (Ruggiu et al., 1997, 2000) cross-reacts with the human protein. As shown on a Western blot (Figure 4), two individuals from the A174 line tested positive for the DAZL protein, which migrates at the same molecular weight as the murine Dazl. Male 769 showed a much stronger expression of the transgene than male 793. Testicular biopsy and immunostaining revealed that male 769 had a testicular tumour with more DAZL-positive cells than were present in the non-tumourous male 793. The normal expression level of DAZL protein was therefore more likely to be reflected in the 793 sample. Thus, expression of the human transgene was much lower when compared with mouse Dazl in wild-type testis.
|
Phenotypic appearance of DazlTm1Hgu/DazlTm1Hgu; TgN gonads
The ability of the human DAZL and DAZ transgenes to rescue the Dazl null phenotype was assessed by evaluation of the phenotypic appearance of the gonads. An initial investigation was carried out on haematoxylin/eosin stained sections (data not shown). Consistent with the results obtained with the YAC transgenic line yS12 (Slee et al., 1999
), we observed in our set of animals only a partial rescue of the germ cell depletion of knockout testes: only a small population of germ cells, mostly peripherally located spermatogonia, populated the testes of Dazl null mice, and an increase was observed in animals carrying the human transgenes. Furthermore, spermatocytes of early prophase stages appeared as a consequence of the presence of human DAZL or DAZ. Interestingly, the same degree of rescue was observed for both human genes.
We used immunostaining of the germ cell nuclear antigen (GCNA1) (Enders and May, 1994) to discriminate between germ cells and Sertoli cells in the testes of transgenic and control knockout animals (Figure 5). Phenotypic effects of the transgenes were quantified by scoring GCNA-positive cells per tubule and the number of GCNA-positive tubules per testis section (Table II). Our results confirmed the observations made with haematoxylin/eosin staining except for line A170: firstly, on average there was an increase in the number of GCNA-positive cells per positive tubule compared with knockout control testes; secondly, the transgenes increased the overall total number of positive tubules. However, there was a lot of variation on the individual male basis, e.g. some testis sections of lines A166.1 and A173 showed patchy staining of GCNA, some areas were totally negative, and others positive. This finding might reflect that the transgenes are only regionally active. However, all transgenic lines had a high incidence of testicular tumours and for this reason up to 50% of transgenic DazlTm1Hgu/DazlTm1Hgu;TgN animals had to be excluded from this analysis. Tumourous parts of the tissues generally did not give any positive GCNA staining. Restricted regional GCNA expression might therefore indicate that part of the tissue is starting to be transformed. For line A170, the number of GCNA-positive cells per tubule was similar to the knockout controls, but the total number of positive tubules was much lower. Unlike in other lines, symplasts (Sertoli cell aggregates) and Sertoli cell proliferation, in multiple layers, were present. Rescue with the DAZL transgene (A174) produced the highest increase in the number of positive cells per tubule as well as in the total number of positive tubules.
|
|
Investigation of the oogonia of female DazlTm1Hgu/DazlTm1Hgu;TgN animals revealed no phenotypic differences compared with knockout tissues (data not shown).
The anti-Dazl antiserum was used to characterize the expression of the DAZL transgene on testis sections by immunohistochemistry. As shown in Figure 6, weak staining of DAZL was observed in spermatogonia, while strong staining of spermatocytes was apparent. Consistently, these cell types are also the origin of the staining pattern observed for the murine Dazl protein in wild-type animals (Ruggiu et al., 1997). In accordance with the subcellular localization of the Dazl proteins in rodents (Ruggiu et al., 1997, 2000), the human DAZL transgene was mainly present in the cytoplasm of expressing cells. Control testes of knockout animals did not give any immunostaining (Figure 6B). However, only a few tubules of transgenic animals had a significant number of DAZL-positive cells. This restricted expression contrasts with the expression of mouse Dazl in wild-type testes where most of the tubules contain Dazl-positive cells. The lower expression level of the human transgene compared with the endogenous murine Dazl seen in Western blots was therefore caused by fewer expressing cells present in the testes and not by insufficient translation of DAZL mRNA in the individual cell.
|
Differentiation of primary spermatocytes
Cytological analysis of the testes of DazlTm1Hgu/DazlTm1Hgu;TgN males revealed that spermatogenesis was still impaired in these animals and that human DAZL and DAZ genes could only induce the initial cellular differentiation from spermatogonial precursors to prophase spermatocytes. Subsequent cellular events of spermatogenesis including the meiotic divisions could not be executed without the presence of the murine Dazl gene product. Investigation of synaptonemal complex structures by electron microscopy was used to characterize the stage of the prophase to which spermatocytes of DazlTm1Hgu/DazlTm1Hgu;TgN animals proceeded. As shown in Figure 7
, lateral elements of the wild-type control showed completion of homologous synapsis. These cells subsequently acquired the competence to execute the first meiotic division (Cobb et al., 1999; Handel et al., 1999). Out of 15 wild-type prophase nuclei investigated, three were of early, five of mid- and seven of late prophase stages, as judged by XY pairing (Moses, 1980). In contrast, in most prophase nuclei prepared from transgenic line A173, synaptonemal complexes were fragmented and synapsis was only partial, indicating that most cells were stuck in leptonema/zygonema stages (Figure 7B). One single cell was seen to progress to an early pachynema stage with apparently complete homologous synapsis (Figure 7C). Later stages were not observed in our cell samples.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionAcknowledgementsReferences |
|---|
In the present study, we have investigated the extent to which human DAZL and DAZ genes can substitute for the functions of the murine homologue, Dazl. The aim of these experiments was to ask if the DAZL and DAZ genes have the same function and if DAZL might therefore be a candidate modifier gene for DAZ deletions. We produced several lines of transgenic mice carrying either human DAZL or DAZ genes on a Dazl null background. Investigation of the phenotypic rescue revealed that both human homologues can only partially substitute for the murine Dazl function. This was the case in multiple mouse strains with different transgene integration sites, implying that similar earlier findings with the DAZ transgene were not due to position effects. Human DAZL and DAZ only complement for Dazl function in early spermatogenic events, leading to an increased germ cell population capable of proceeding to early pachynema stage in rare cases. Most differentiating spermatocytes arrest in the leptonema/zygonema stages.
Human DAZ and DAZL function might be mediated through interaction with other proteins and either the interaction or the proteins themselves might be dispensable in mouse. Or, vice versa, protein interaction in the mouse may not be mediated by the human proteins.
The introduction of the human homologues gives a more detailed picture of how Dazl affects the differentiation of spermatocytes by exploiting the partial rescue. Our study of transgenic spermatocytes using electron microscopy has shown that without complete Dazl function, early spermatocytes cannot proceed to a stage of complete homologous synapsis and synaptonemal complex formation, characteristic of cells that will acquire the competence to enter the meiotic divisions. The effects of reductions in the level of Dazl protein on later stages of spermiogenesis are apparent in males heterozygous for the null allele (Ruggiu et al., 1997; Vogel et al., 1999). If we accept that members of the DAZL family function through the binding of RNA, then only a subset of possible mouse Dazl target mRNAs are efficiently targeted by the human proteins: successfully regulated mRNAs are part of the early Dazl functions. In contrast, at least some functions necessary to induce later stages of spermatocyte differentiation and meiotic divisions are clearly not replaceable by the human genes.
The complementation capacity of human DAZL emphasises that with the emergence of a Y-chromosomal homologue, either DAZL or DAZ protein function and/or the targeted mRNAs were modulated in the course of evolution. Two explanations for the differences in function of the human and mouse genes are possible. Firstly, the entire process of spermatogenesis is differently organized in humans and mice and the DAZ/DAZL genes are implicated in different spermatogenic events. Secondly, human genes are not efficiently targeting the same mRNAs in the mouse because of co-evolution of the proteins and their target RNAs. This suggests that DAZL and DAZ act either on different target genes than mouse Dazl or that DAZL/DAZ protein function on the same target RNA is mediated through different binding sequences. Little is known about Dazl function with respect to target molecules in mammals, but reported experiments have suggested that in Drosophila one of boule’s targets is twine, a germ cell-specific fly homologue of the cell cycle regulator protein cdc25 (Maines and Wasserman, 1999). A new relative of the Dazl gene family, Boule, was also identified in mouse and human (Xu et al., 2001). This gene, though closely related to Dazl and DAZ, is more likely to be the functional homologue of Drosophila’s boule than Dazl. Expression of Boule genes slightly overlaps Dazl expression but is mainly observed in meiotic cells (Xu et al., 2001). Given the high homology of Dazl and Boule genes (Xu et al., 2001), this evidence might also establish a link between Dazl and components of the cell cycle machinery that are responsible for meiotic divisions.
Interestingly, one of the candidate target mRNAs of the Dazl/Boule gene family, cdc25c, shows striking sequence differences between mice and humans in the 5' UTR region. Regulatory sequences used in mouse might not be present in the human Cdc25c 5' UTR. It is tempting to speculate that sequence variations determine that the human homologues cannot bind and regulate the translation of their normal target cdc25c in the mouse. This assumption might be corroborated by reports showing that Cdc25c protein appears in spermatocytes of mid- to late pachynema (Cobb et al., 1999; Handel et al., 1999), a prophase stage that is never reached in DazlTm1Hgu/DazlTm1Hgu;TgN males. Furthermore, an immunohistochemical investigation has revealed that Dazl expression precisely precedes the translation of cdc25c, consistent with a regulative function of Dazl on cdc25c (T.Vogel, unpublished observation).
Partial rescue might also result from a requirement for human DAZL and DAZ in the same cell to complete spermatogenesis. Our DazlTm1Hgu/DazlTm1Hgu;DAZ or DAZL transgenic animals might be equivalent to human AZFc-deleted individuals with impaired spermatogenesis. It is likely that mutations in the autosomal human homologue, DAZL, would have the same phenotypic consequence. However, deleterious mutations of human DAZL have not yet been described. One method to investigate this assumption would be to cross the human DAZL and DAZ together on the Dazl null background and to assess the phenotypic consequences. The outcome of this investigation has important relevance for the clinical treatment of infertile deletion patients. If the AZFc phenotype reflects that only dosage of DAZL and DAZ is important and if both genes have the same function, drugs that could induce an increased DAZL expression could possibly compensate for the loss of the Y-chromosomal genes. On the other hand, if DAZL and DAZ have different and additive functions, replacement therapies for the DAZ genes have to be applied. The results obtained for various DAZ transgenics are based on the introduction of PAC-cloned DNA and are consistent with the degree of rescue that was previously observed with the YAC-cloned DAZ gene (Slee et al., 1999). Here it was considered that the partial rescue observed could have been caused by (i) insufficient expression of the transgene evoked by alterations of the input DNA resulting in the loss of 5' regulatory sequences, and (ii) variable transcript expression through silencing position effects. In our study, we did not observe phenotypic variability that we could relate to different locations of the transgenes. But although our transgenic mouse lines contained the 5' sequences, the DAZ gene used in this study was truncated at the 3' end and regulatory sequences in the 3' untranslated region (UTR) could have been missing. The overlap between the observed phenotypes in the two studies would therefore suggest two options. Firstly there may be an imperfect expression through the lack of enhancing regulatory sequences at either the 5' or 3' end. Secondly it might indicate that intrinsic DAZ function is differently implemented in germ cell development when compared with murine Dazl.
The DAZ genes are organized as a gene family on the Y chromosome and it has been shown by the isolation of a heterogeneous pool of DAZ cDNAs from human testis that more than one DAZ gene is transcribed (Yen et al., 1997). However it is possible that only specific member(s) produce a functional protein, but partial rescue could still be a function of the particular DAZ genes used. Recent detailed analysis of the DAZ gene cluster suggests that there are four genes, three of which are transcribed, and two genes have multiple RNA binding motifs which could lead to differences in function of the protein (Saxena et al., 2000).
The DAZ repeat region is another major structural difference between the homologous Y-chromosomal DAZ and autosomal DAZL genes. Another possible explanation for partial rescue of DAZ genes might be that the presence of the DAZ repeat abolishes a Dazl-specific gene function. Two observations reported in this study argue against this assumption. (i) Rescue was observed in the DAZ-carrying line A166.1 with a large deletion encompassing the DAZ repeat region. This finding indicates that the DAZ repeat region might be dispensable for the DAZ function observed. However, we cannot generally exclude that the DAZ repeat might be of functional importance in the context of human spermatogenesis. (ii) The human DAZL gene, devoid of any repeat, can only substitute for early functions of its murine homologue.
Clearly, the interpretation of all DAZ-based rescue experiments is limited by the rearranged and incomplete nature of the transgenes. Yet, this problem will not be easily overcome, given the apparently high predisposition for rearrangement, amplification and pruning processes in-between DAZ sequences.
|
Acknowledgements |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionAcknowledgementsReferences |
|---|
The authors would like to thank the animal technicians of the MRC TG facility for supporting mouse work, Dr B.Grimes, Dr R.Slee and N.I.McGill for technical tips and discussion, and M.Lee for FISH support. This work was supported by the MRC and the Wellcome Trust through a grant to T.V. (no. 055047).
|
Notes |
|---|
1 Present address: Max-Planck-Institute for Biophysical Chemistry, Am Fassberg 11, 37077 Göttingen, Germany
2 To whom correspondence should be addressed. E-mail: howard{at}hgu.mrc.ac.uk
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionAcknowledgementsReferences |
|---|
Chang, P.L., Sauer, M.V. and Brown, S. (1999) Y chromosome microdeletion in a father and his four infertile sons. Hum. Reprod., 14, 2689–2694.
Cobb, J., Cargile, B. and Handel, M.A. (1999) Acquisition of competence to condense metaphase I chromosomes during spermatogenesis. Develop. Biol., 205, 49–64.[Web of Science][Medline]
Cooke, H.J., Lee, M., Kerr, S. and Ruggiu, M. (1996) A murine homolog of the human DAZ gene is autosomal and expressed only in male and female gonads. Hum. Mol. Genet., 5, 513–516.
Eberhart, C.G., Maines, J.Z. and Wasserman, S.A. (1996) Meiotic cell-cycle requirement for a fly homolog of human deleted in azoospermia. Nature, 381, 783–785.[Medline]
Elliott, D.J., Millar, M.R., Oghene, K., Ross, A., Kiesewetter, F., Pryor, J., McIntyre, M., Hargrave, T.B., Saunders, P.T.K., Vogt, P.H. et al. (1997) Expression of RBM in the nuclei of human germ cells is dependent on a critical region of the Y chromosome long arm. Proc. Natl Acad. Sci. USA, 94, 3848–3853.
Enders, G.C. and May II, J.J. (1994) Developmentally regulated expression of a mouse germ cell nuclear antigen examined from embryonic day 11 to adult in male and female mice. Dev. Biol., 163, 331–340.[Web of Science][Medline]
Gläser, B., Yen, P.H. and Schempp, W. (1998) Fibre-fluorescence in situ hybridization unravels apparently seven DAZ genes of pseudogenes clustered within a Y-chromosome region frequently deleted in azoospermic males. Chromosome Res., 6, 481–486.[Web of Science][Medline]
Handel, M.A., Cobb, J. and Eaker, S. (1999) What are the spermatocyte’s requirements for successful meiotic division? J. Exp. Zool., 285, 243–250.[Web of Science][Medline]
Herring, C.D., Chevillard, C., Johnston, S.L., Wettstein, P.J. and Riblet, R. (1998) Vector-hexamer PCR isolation of all insert ends from a YAC contig of the mouse Igh locus. Genome Res., 8, 673–681.
Houston, D. W. and King, M. L. (2000) A critical role for Xdazl, a germ plasm-localized RNA in the differentiation of primordial germ cells in Xenopus. Development, 127, 447–456.[Abstract]
Houston, D.W., Zhang, J., Maines, J.Z., Wasserman, S.A. and King, M.L. (1998) A Xenopus DAZ-like gene encodes an RNA component of germ plasm and is a functional homologue of Drosophila boule. Development, 125, 171–180.[Abstract]
Ioannou, P.A., Amemiya, C.T., Garnes J., Kroisel, P.M., Shizuya, H., Chen, C., Batzer, M.A. and de Jong, P.J. (1994) A new bacteriophage P1-derived vector for the propagation of large human DNA fragments. Nature Genet., 6, 84–89.[Web of Science][Medline]
Karashima, T., Sugimoto, A. and Yamamoto, M.A. (1997) C.elegans homologue of DAZ/boule is involved in progression through meiosis during oogenesis. Worm Breeders Gazette, 15, 65–66.
Lahn, B.T. and Page, D.C. (1997) Functional coherence of the human Y chromosome. Science, 278, 675–680.
Maegawa, S., Yasuda, K. and Inoue, K. (1999) Maternal localization of zebrafish DAZ-like gene. Mech. Dev., 81, 223–226.[Web of Science][Medline]
Maines, J.Z. and Wasserman, S.A. (1999) Post-transcriptional regulation of the meiotic Cdc25 protein Twine by the Dazl orthologue Boule. Nature Cell Biol., 1, 171–174.[Web of Science][Medline]
Moses, M.J. (1980) New Cytogenetic Studies on Mammalian Meiosis. In Serio, M. and Martini, L. (eds) Human Models in Human Reproduction. Raven Press, New York, USA, pp. 169–190.
Reijo, R., Lee, T.Y., Salo, P., Alagappan, R., Brown, L.G., Rosenber, M., Rozen, S., Jaffe, T., Straus, D., Hovatta, O. et al. (1995) Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nature Genet., 10, 383–393.[Web of Science][Medline]
Ruggiu, M., Speed, R., Taggart, M., McKay, S.J., Kilanowski, F., Saunders, P., Dorin, J. and Cooke, H.J. (1997) The mouse Dazla gene encodes a cytoplasmic protein essential for gametogenesis. Nature, 389, 73–77.[Medline]
Ruggiu, M., Saunders, P.T.K. and Cooke, H.J. (2000) Dynamic subcellular distribution of the Dazl protein is confined to primate male germ cells. Int. J. Andr., 21, 470–477.
Saxena, R., Brown, L.G., Hawkins, T. Alagappan, R.K., Skaletsky, H., Reeve, M.P., Reijo, R., Rozen, S., Dinulos, M.B., Disteche, C. et al. (1996) The DAZ gene cluster on the human Y chromosome arose from an autosomal gene that was transposed, repeatedly amplified and pruned. Nature Genet., 14, 292–298.[Web of Science][Medline]
Saxena, R., de Vries, J.W., Repping, S., Alagappan R.K., Skaletsky H., Brown L.G., Ma P., Chen E., Hoovers J.M. and Page D.C. (2000) Four DAZ genes in two clusters found in the AZFc region of the human Y chromosome. Genomics, 67, 256–267.[Web of Science][Medline]
Slee, R., Grimes, B., Speed, R.M., Taggart, M., Maguire, S.M., Ross, A., McGill, N.I., Saunders, P.T.K. and Cooke, H.J. (1999) A human DAZ transgene confers partial rescue of the mouse Dazl null phenotype. Proc. Natl Acad. Sci. USA, 96, 8040–8045.
Speed, R.M. and Chandley, A.C. (1990) Prophase meiosis in human spermatocytes analysed by EM microspreading in infertile men and their controls and comparisons with human oocytes. Hum. Genet., 84, 547–554.[Web of Science][Medline]
Vereb, M., Agulnik, A.I., Houston, J.T., Lipschultz, L.I., Lamb, D.J. and Bishop, C.E. (1997) Absence of DAZ gene mutations in cases of non-obstructed azoospermia. Mol. Hum. Reprod., 3, 55–59.
Vogel, T., Speed, R.M., Teague, P. and Cooke, H.J. (1999) Mice with Y chromosome deletion and reduced Rbm genes on a heterogenous Dazl1 null background mimic a human azoospermic factor phenotype. Hum. Reprod., 14, 3023–3029.
Vogt, P.H., Edelmann, A., Kirsch, S., Henegariu, P., Hirschmann, P., Kiesewetter, F., Köhn, F.M., Schill, W.B., Farah, S., Ramos, C. et al. (1996) Human Y-chromosome azoospermia factors (AZF) mapped to different subregions in Yq11. Hum. Mol. Genet., 5, 933–943.
Wong, J., Blanco, P. and Affara, N.A. (1999) An exon map of the AZFc male infertility region of the human Y chromosome. Mamm. Genome, 10, 57–61.[Web of Science][Medline]
Wu, C., Zhu, S., Simpson, S. and de Jong, P.J. (1996) DOP-vector PCR: a method for rapid isolation and sequencing of insert termini from PAC clones. Nucleic Acid Res, 24, 2614–2615.
Xu, E.Y., Moore, F.L. and Pera, R.A. (2001) A gene family required for human germ cell development evolved from an ancient meiotic gene conserved in all metazoans. Proc. Natl Acad. Sci. USA, 98, 7414–7419.
Yen, P.H., Chai, N.N. and Salido, E.C. (1997) The human DAZ genes, a putative male infertility factor on the Y Chromosome, are highly polymorphic in the DAZ repeat regions. Mamm. Genome, 8, 756–759.[Web of Science][Medline]
Submitted on December 7, 2001; resubmitted on February 25, 2002; accepted on May 15, 2002.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  E. Kostova, C.H. Yeung, C.M. Luetjens, M. Brune, E. Nieschlag, and J. Gromoll Association of three isoforms of the meiotic BOULE gene with spermatogenic failure in infertile men Mol. Hum. Reprod., February 1, 2007; 13(2): 85 - 93. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Otori, T. Karashima, and M. Yamamoto The Caenorhabditis elegans Homologue of Deleted in Azoospermia Is Involved in the Sperm/Oocyte Switch Mol. Biol. Cell, July 1, 2006; 17(7): 3147 - 3155. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Jovelin, S. Berthaud, and G. Lucotte Molecular basis of the TaqI p49a,f polymorphism in the DYS1 locus containing DAZ genes Mol. Hum. Reprod., September 1, 2003; 9(9): 509 - 516. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Schubert, B. Skawran, F. Dechend, K. Nayernia, A. Meinhardt, I. Nanda, M. Schmid, W. Engel, and J. Schmidtke Generation and Characterization of a Transgenic Mouse with a Functional Human TSPY Biol Reprod, September 1, 2003; 69(3): 968 - 975. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||