Molecular Human Reproduction, Vol. 9, No. 1, 35-40,
January 2003
© 2003 European Society of Human Reproduction and Embryology
Article |
The induction of baboon glycodelin expression by progesterone is not through Sp1
Submitted on September 9, 2002; accepted on October 10, 2002
Departments of 1 Physiology and Biophysics and 2 Obstetrics and Gynecology, University of Illinois at Chicago, Chicago, IL 60612, USA 3 To whom correspondence should be addressed at: Department of Physiology and Biophysics (M/C901), University of Illinois at Chicago, 835 S. Wolcott, Chicago, IL 60612-7342, USA. e-mail: rcjaffe{at}uic.edu
| ABSTRACT |
|---|
|
|
|---|
Glycodelin is a major secretory product of the uterine glandular epithelial cells of the human and non-human primate during the late luteal phase of the menstrual cycle and early pregnancy. Since progesterone levels are elevated during these periods we sought to determine how progesterone modulates glycodelin gene expression. Co-transfection of various deletions of the baboon glycodelin promoter with the progesterone receptor (PR) into Ishikawa cells, a human endometrial cell line, revealed that full progesterone responsiveness is retained within the region 119/+48. In COS-1 cells, a kidney cell line, progesterone failed to elevate luciferase levels when various deletion constructs and the PR were co-transfected. Mutation of the Sp1 site in the 67/+48 region lowered basal expression but did not affect the ability of progesterone to increase expression of the luciferase reporter in Ishikawa cells. These findings suggest that Sp1 sites are not involved in the progesterone regulation of the baboon glycodelin gene. We propose that progesterone induces a factor that regulates glycodelin gene expression in the uterus since we failed to obtain a similar response in a non-uterine cell line.
Key words: baboon/gene regulation/glycodelin/Sp1/uterus
| Introduction |
|---|
|
|
|---|
Glycodelin, originally called placental protein 14 (PP14), is the major secretory product of the glandular epithelial cells of the human uterus during the late luteal phase of the menstrual cycle and early pregnancy (Bell et al., 1985). In the baboon, glycodelin synthesis begins in the uterine glandular epithelial cells during the mid-luteal phase and increases dramatically during early pregnancy (Hausermann et al., 1998). The increase in glycodelin secretion by the glandular epithelium of the uterus is coincident with progesterone secretion during the luteal phase of the menstrual cycle. Glycodelins role in reproduction may be to inhibit sperm binding to the zona pellucida (Oehninger et al., 1995) or serve as an immunosuppressive agent during early pregnancy (Bolton et al., 1987).
Transcriptional regulation of the human glycodelin gene promoter in Ishikawa and HeLa cells is regulated via the progesterone receptor (PR) (Taylor et al., 1998). In HEC1B cells, PR-stimulated glycodelin gene expression has been reported to be mediated through functional Sp1 sites (Gao et al., 2001). However, the transcriptional regulation of the baboon glycodelin gene has not been studied. In this study, we have demonstrated that although the baboon glycodelin gene promoter activity is enhanced by progesterone, it does not mediate its actions via Sp1 sites.
| Materials and methods |
|---|
|
|
|---|
Materials
pGL3-Basic, pGEM-T Easy, ß-Galactosidase Enzyme Assay System and Luciferase Assay System were purchased from Promega (Madison, WI, USA). pCMV Sport-ßgal, Dulbeccos modified Eagles medium (DMEM), phenol red free DMEM, fetal bovine serum and other tissue culture supplies were obtained from Invitrogen (Carlsbad, CA, USA). pBluescriptII SK- and the QuikChange Site-Directed Mutagenesis Kit were purchased from Stratagene (La Jolla, CA, USA). The Sp1 monoclonal antibody was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA) and the enhanced chemiluminescence kit was obtained from Amersham Biosciences Corp. (Piscataway, NJ, USA). The human PRB plasmid and progesterone response element (PRE)luciferase plasmids were a gift from Dr Ming-Jer Tsai (Baylor College of Medicine), the human PRA plasmid was a gift from Dr Pierre Chambon (University of Strasbourg), and the Sp1 expression plasmid was a gift from Dr Guntram Suske (University of Marburg).
Promoter isolation and DNA cloning
A male baboon kidney tissue genomic library in Lambda Dash II was initially screened using a sense primer designed to match a region in exon 1 (5'-CCCCCAGACCAAGCAGGACCTGGAGCTCCC-3') and an antisense primer (5'-ACGATCTCCAGGTTGTCCTC-3') matching a region of exon 2 of the human glycodelin gene [accession no. M34046 (Vaisse et al., 1990)] to reduce the complexity of the library (Amaravadi and King, 1994). Final screening was carried out on colony lifts using a randomly labelled human glycodelin cDNA probe (the plasmid containing the insert was a gift from Dr Stephen Bell, University of Leicester) (Sambrook et al., 1989). The insert was subcloned into the NotI site of pBluescriptII SK-. A fragment of the 5' flanking region corresponding to 2 kb to +48 bp of the human glycodelin gene was amplified using the sense primer 5'-gagctcttacGCGTTCCTCCTGCTCG CTGAGG-3' (the letters in lower case indicating nucleotides added to facilitate cloning) designed to correspond to nucleotides 1903 to 1882 and the antisense primer 5'-agatctcgaGGCTGCGGCTGTGGGTGGCT-3' designed to correspond to nucleotides +48 to +29 of the human glycodelin gene (Vaisse et al., 1990). After purification on a 1.5% agarose gel the amplicon was cloned into the pGEM-T Easy vector.
Plasmid constructions
The pGEM-T Easy construct containing the amplicon,
2 kb, was digested with XhoI and MluI and the insert separated from the vector by electrophoresis on a 1.5% agarose gel. The band containing the amplicon was purified and ligated into the pGL3-Basic vector, which was also digested with XhoI and MluI, upstream of the firefly luciferase reporter gene creating 2007/+48pGL3-Basic. The 808/+48pGL3-Basic plasmid was derived from 2007/+48pGL3-Basic by digestion with NdeI, purification by agarose gel electrophoresis and religation. The 506/+48pGL3-Basic plasmid was generated by digesting the 2007/+48pGL3-Basic plasmid with NheI followed again by purification and religation. The 119/+48pGL3-Basic and 67/+48pGL3-Basic plasmids were generated by PCR amplification using the same antisense primer as above and the primers gagctcttacgcgtCAGTGGAGGAAGCTGC and gagctcttacgcgtCA CATGGCTGTGGGCAG respectively, followed by subcloning into the pGL3-Basic plasmid as described above. The mut67/+48pGL3-Basic was generated from the 67/+48pGL3-Basic plasmid using the QuikChange Site-Directed Mutagenesis Kit and the sense primer CACATGGCTGTGGGAAAGGCT TTTGTCTGCCCTCCTC and antisense primer GAGGAGGGCAGACAAAA GCCTTTCCCACAGCCATGTG (the altered bases are underlined), which span bases 67 to 31. All constructs were verified by sequencing through the insert-vector junction by the DNA Sequencing Facility of the Research Resources Center of UIC.
Cell culture, transfection and luciferase assay
Ishikawa or COS-1 cells were cultured in DMEM supplemented with 10% FCS, 100 IU/ml penicillin and 100 µg/ml streptomycin. The cells were grown at 37°C in a humidified atmosphere with 5% CO2. On the day before transfection the cells were plated at a concentration of 1.1x105 cells/cm2 into 12-well plates in triplicate in phenol red free DMEM supplemented with 2% charcoal stripped fetal calf serum (FCS), 100 U/ml penicillin and 100 µg/ml streptomycin. The cells were transfected with plasmids using the calcium phosphate precipitation method (Sambrook et al., 1989). In the total of 2.75 µg of plasmid/well were 0.25 µg of pCMV Sport-ßgal and 2.5 µg of equal amounts of the luciferase reporter plasmid and PR (PRB in all experiments except for the experiment in Figure 3 where both PRA and PRB were used), Sp1 or pGL3-Basic plasmids. After incubation with the plasmids for 4 h, the cells were washed, glycerol shocked, and placed in media in the presence or absence of 1 µmol/l medroxyprogesterone acetate (MPA) for 20 h. The cells were then harvested in reporter lysis buffer, luciferase activity measured with the Luciferase Assay System and ß-galactosidase with the ß-Galactosidase Enzyme Assay System.
|
Western blot
Nuclear extracts (50 µg), prepared as described by Dignam et al., 1983 from Ishikawa and COS-1 cells were resolved on sodium dodecyl sulphatepolyacrylamide gel electrophoresis gels and transferred to nitrocellulose membranes (Towbin et al., 1979). The membranes were incubated with an Sp1 monoclonal antibody at a 1:100 dilution and the immunoreactive product visualized by using an enhanced chemiluminescence kit.
Statistical analysis
Data are expressed as means ± SD of triplicates and statistical analysis of the significance of the difference between the cells treated with and without MPA was carried out using Students t-test. Differences were considered statistically significant at P < 0.05.
| Results |
|---|
|
|
|---|
To investigate the progesterone regulation of the baboon glycodelin gene, a DNA fragment containing the 2 kb region 5' of the transcriptional start site and 48 bases downstream was generated from a larger genomic clone by PCR. Figure 1 shows the sequence of this 2055 bp fragment (GenBank accession no. AF519801). This segment is 92% identical to the previously cloned human promoter (Vaisse et al., 1990). The regions proposed to correspond to a putative glucocorticoid response element (GRE), CAAT box and TATAA box are identical in the human and baboon (Vaisse et al., 1990) (Figure 2), while each of the proposed binding sites for the transcription factor Sp1 have at least one base change.
|
|
In Ishikawa cells, a human endometrial cell line, the A and B forms of the human PR were equally effective in inducing luciferase expression in response to the synthetic progestin MPA from the co-transfected glycodelin 2007/+48pGL3-Basic luciferase reporter construct (Figure 3). A chimeric plasmid containing the luciferase reporter gene linked to the PRE also exhibited progestin-dependent induction with either form of the PR.
To determine which region within the promoter was responsible for the progestin responsiveness, progressively shorter fragments linked to the luciferase reporter gene were analysed in the Ishikawa cell line. As can be seen in Figure 4, 808/+48pGL3-Basic, in which the putative GRE was removed, had a lower level of expression in the absence of MPA but exhibited no loss in progestin response; the MPA increased the expression of the 808/+48pGL3-Basic 4.6-fold, while the other groups ranged from 2.9- to 4.4-fold. Progressive deletions to 506, 368 (with the removal of the putative CREB site), and 119 (with the removal of the two distal putative Sp1 sites designated Sp1-1 and Sp1-2 by Gao et al., 2001) also were not associated with any loss in progestin responsiveness. Only when the entire glycodelin fragment was removed (Basic) was there a drastic reduction in the basal and progestin-induced luciferase activity.
|
In COS-1 cells, a kidney cell line from African green monkeys, MPA failed to increase luciferase in either the 2007/+48pGL3-Basic or 119/+48pGL3-Basic chimeric plasmids (Figure 5). However, MPA was able to induce expression when the PRE was co-transfected with the PRB in the COS-1 cells.
|
Since the 119/+48 region of the glycodelin gene promotor lacks a consensus PRE, it is possible that PR interacts with another transcription factor and promotes expression via the response element for this transcription factor. One candidate for such an interaction with the PR is the transcription factor Sp1 (Suske, 1999). One could hypothesize that (i) MPA induces glycodelin gene expression in the Ishikawa cells but not the COS-1 cells because Sp1 is present in Ishikawa cells but not the COS-1 cells or (ii) that the COS-1 cells had an overabundance of Sp1 so that the expression from the glycodelin promoter was maximally activated before the addition of the progestin. Western blot analysis (Figure 6) demonstrated that neither scenario was true. The levels of Sp1 in Ishikawa and COS-1 cell were comparable.
|
The possibility that PR was interacting with Sp1 to induce glycodelin through the Sp1 site at 55/50 (corresponding to the human Sp1 site designated Sp1-3 by (Gao et al., 2001) was tested by mutating the Sp1 site. As can be seen in Figure 7, in Ishikawa cells MPA increases luciferase expression in both the native 67/+48pGL3-Basic and mutated 67/+48pGL3-Basic construct. Although apparently not necessary for the response to the progestin, the overall levels of expression in the mutant are lower than in the native construct indicating that basal expression is increased by the Sp1 element. Similar results were seen when the experiment was repeated using HEC-1B cells (data not shown).
|
| Discussion |
|---|
|
|
|---|
During the late luteal phase of the menstrual cycle and early pregnancy glycodelin is the major secretory product of the human glandular epithelium (Bell et al., 1985). In the baboon, glycodelin synthesis begins in glandular epithelium during the mid-luteal phase and increases dramatically during early pregnancy (Hausermann et al., 1998). Proposed functions for glycodelin include inhibiting spermzona interaction (Oehninger et al., 1995) and immunosuppression (Bolton et al., 1987). This latter action may be due to a stimulation of apoptosis in T cells but not monocytes (Mukhopadhyay et al., 2001).
Not surprisingly, the 2007 bp 5' of the transcription start site of the baboon glycodelin gene has a high degree of identity to the human glycodelin gene. This includes the complete identity of the putative GRE, CAAT box and TATAA box of the human glycodelin gene (Vaisse et al., 1990) with the corresponding region of the baboon glycodelin promoter. However, each of the putative Sp1 sites is altered with at least a G to A conversion. A change from G to A in the Sp1 binding sequence has been reported to result in a 3-fold loss in Sp1 binding activity (Letovsky and Dynan, 1989). Deletion of the two distal Sp1 sites (244/239 and 204/199) is not associated with any change in the basal or progestin response (Figure 4), which is in contrast with the results of Gao et al. (Gao et al., 2001) who found that mutations of the analogous sites in the human glycodelin promoter did drastically lower expression. We did find that mutating the Sp1 site at 55/50 did lower basal expression. It is not clear if the potential distal Sp1 sites in the baboon are inactive solely because of the base change in the sequence.
Two forms of the PRPRA and PRBare found in many progesterone responsive cells. These forms arise from a single gene through the initiation of transcription at two distinct promoters and the use of alternative start codons for translation (Conneely et al., 1987, 1989; Kastner et al., 1990). In certain circumstances the PRA form may be inactive or inhibitory (Giangrande and McDonnell, 1999). In the Ishikawa cells both PRA and PRB increase luciferase levels from both the PRE and glycodelin reporter plasmids. The human glycodelin promoter was also found to be induced equally by PRA and PRB in HEC-1B cells (Gao et al., 2001).
Deletion of the glycodelin promoter regions containing putative GRE and CAMP response element binding protein (CREB) elements (2007 to 808 and 506 to 368 respectively) did not alter the induction of luciferase by the synthetic progestin MPA. Further deletions to 119 and 67 with the removal of the two distal putative Sp1 response elements (referred to as Sp1-1 and -2 by Gao et al., 2001) were also not associated with any loss in progestin responsiveness.
In COS-1 cells, luciferase activity was increased in cells co-transfected with the PRB- and the PRE-containing luciferase plasmids in response to MPA. This indicates that the machinery exists within these cells for a direct effect of the PR on its response element. However, in the COS-1 cells the glycodelinluciferase reporter construct containing the 2007/+48 element failed to exhibit any progestin-induced response. Reporter plasmids containing 119/+48 of the 5' flanking sequence also did not have a MPA response in the COS-1 cells. Since these cells were responsive when the PRE was co-transfected we conclude that the PR is not acting on the glycodelin promoter directly.
Sp1 is a ubiquitously expressed transcription factor that has been implicated in the activation of a number of genes (Suske, 1999). In certain progesterone responsive genes the PR does not directly activate the gene. Instead, the PR activates the gene in an indirect manner by interacting with Sp1 that then binds as a complex to the Sp1 response element. Our findings on the difference in response of the reporter constructs to MPA in Ishikawa and COS-1 cells could have been due to significant differences in the levels of Sp1 within these two cell lines. Western blot analysis indicated that this could not explain our findings since the Ishikawa and COS-1 cell lines contained similar amounts of Sp1. That this was not the case was further shown by mutating the putative Sp1 response element in the 67/+48 glycodelin reporter plasmid. Although the overall level of luciferase production in the mutant plasmid was lower than in the native construct, the ability of MPA to induce a response in the Ishikawa cells was retained.
We propose that progestins only indirectly activate the glycodelin gene. Since MPA failed to induce a response in COS-1 cells we believe the PR acts in the Ishikawa cells, a progestin responsive cell line, to induce the production of a transcription factor, which in turn activates the glycodelin gene promoter, or a pre-existing factor exists, which is found in Ishikawa cells but not COS-1 cells. In COS-1 cells that are not progestin responsive, the production of this transcription factor is not inducible. Studies are underway to define what this transcription factor is and the sequence of its response element.
| Acknowledgements |
|---|
We thank Dr Bruce Lessey for providing us with the Ishikawa cells. These studies were carried out as part of the National Cooperative Program on Markers of Uterine Receptivity supported by NIH grant HD29964 to A.T.F.
| REFERENCES |
|---|
|
|
|---|
Amaravadi, L. and King, M.W. (1994) A rapid and efficient, nonradioactive method for screening recombinant DNA libraries. Biotechniques, 16, 98103.[ISI][Medline]
Bell, S.C., Hales, M.W., Patel, S., Kirwan, P.H. and Drife, J.O. (1985) Protein synthesis and secretion by the human endometrium and decidua during early pregnancy. Br. J. Obstet. Gynecol., 92, 793803.[ISI][Medline]
Bolton, A.E., Pockley, A.G., Clough, K.J., Mowles, E.A., Stoker, R.J., Westwood, O.M. and Chapman, M.G. (1987) Identification of placental protein 14 as an immunosuppressive factor in human reproduction. Lancet, i, 593595.
Conneely, O.M., Maxwell, B.L., Toft, D.O., Schrader, W.T. and OMalley, B.W. (1987) The A and B forms of the chicken progesterone receptor arise by alternate initiation of translation of a unique mRNA. Biochem. Biophys. Res. Commun., 149, 493501.[CrossRef][ISI][Medline]
Conneely, O.M., Kettelberger, D.M., Tsai, M.J., Schrader, W.T. and OMalley, B.W. (1989) The chicken progesterone receptor A and B isoforms are products of an alternate translation initiation event. J. Biol. Chem., 264, 1406214064.
Dignam, J.D., Lebovitz, R.M. and Roeder, R.G. (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res., 11, 14751489.
Gao, J., Mazella, J., Seppala, M. and Tseng, L. (2001) Ligand activated hPR modulates the glycodelin promoter activity through the Sp1 sites in human endometrial adenocarcinoma cells. Mol. Cell. Endocrinol., 176, 97102.[CrossRef][ISI][Medline]
Giangrande, P.H. and McDonnell, D.P. (1999) The A and B isoforms of the human progesterone receptor: two functionally different transcription factors encoded by a single gene. Recent Prog. Horm. Res., 54, 291313.[Medline]
Hausermann, H.M., Donnelly, K.M., Bell, S.C., Verhage, H.G. and Fazleabas, A.T. (1998) Regulation of the glycosylated beta-lactoglobulin homolog, glycodelin [placental protein 14: (PP14)] in the baboon (Papio anubis) uterus. J. Clin. Endocrinol. Metab., 83, 12261233.
Kastner, P., Krust, A., Turcotte, B., Stropp, U., Tora, L., Gronemeyer, H. and Chambon, P. (1990) Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J., 9, 16031614.[ISI][Medline]
Letovsky, J. and Dynan, W.S. (1989) Measurement of the binding of transcription factor Sp1 to a single GC box recognition sequence. Nucleic Acids Res., 17, 26392653.
Mukhopadhyay, D., Sundereshan, S., Rao, C. and Karande, A.A. (2001) Placental protein 14 induces apoptosis in T cells but not in monocytes. J. Biol. Chem., 276, 2826828273.
Oehninger, S., Coddington, C.C., Hodgen, G.D. and Seppala, M. (1995) Factors affecting fertilization: endometrial placental protein 14 reduces the capacity of human spermatozoa to bind to the human zona pellucida. Fertil. Steril., 63, 377383.[ISI][Medline]
Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Press, Cold Spring Harbor.
Suske, G. (1999) The Sp-family of transcription factors. Gene, 238, 291300.[CrossRef][ISI][Medline]
Taylor, R.N., Savouret, J.F., Vaisse, C., Vigne, J.L., Ryan, I., Hornung, D., Seppala, M. and Milgrom, E. (1998) Promegestone (R5020) and mifepristone (RU486) both function as progestational agonists of human glycodelin gene expression in isolated human epithelial cells. J. Clin. Endocrinol. Metab., 83, 40064012.
Towbin, H., Staehelin, T. and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl Acad. Sci. USA, 76, 43504354.
Vaisse, C., Atger, M., Potier, B. and Milgrom, E. (1990) Human placental protein 14 gene: sequence and characterization of a short duplication. DNA Cell Biol., 9, 401413.[ISI][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
M. K. Tee, J.-L. Vigne, J. Yu, and R. N. Taylor Natural and recombinant human glycodelin activate a proapoptotic gene cascade in monocyte cells J. Leukoc. Biol., April 1, 2008; 83(4): 843 - 852. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. O. Burney, S. Talbi, A. E. Hamilton, K. C. Vo, M. Nyegaard, C. R. Nezhat, B. A. Lessey, and L. C. Giudice Gene Expression Analysis of Endometrium Reveals Progesterone Resistance and Candidate Susceptibility Genes in Women with Endometriosis Endocrinology, August 1, 2007; 148(8): 3814 - 3826. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C Jaffe, S. D Ferguson-Gottschall, W. Gao, C. Beam, and A. T Fazleabas Histone deacetylase inhibition and progesterone act synergistically to stimulate baboon glycodelin gene expression J. Mol. Endocrinol., March 1, 2007; 38(3): 401 - 407. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Georgiakaki, N. Chabbert-Buffet, B. Dasen, G. Meduri, S. Wenk, L. Rajhi, L. Amazit, A. Chauchereau, C. W. Burger, L. J. Blok, et al. Ligand-Controlled Interaction of Histone Acetyltransferase Binding to ORC-1 (HBO1) with the N-Terminal Transactivating Domain of Progesterone Receptor Induces Steroid Receptor Coactivator 1-Dependent Coactivation of Transcription Mol. Endocrinol., September 1, 2006; 20(9): 2122 - 2140. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










