Molecular Human Reproduction, Vol. 9, No. 1, 41-45,
January 2003
© 2003 European Society of Human Reproduction and Embryology
Article |
Leukocyte density and pro-inflammatory cytokine expression in human fetal membranes, decidua, cervix and myometrium before and during labour at term
Submitted on July 5, 2002; accepted on October 2, 2002
University of Glasgow Department of Obstetrics and Gynaecology, 3rd Floor, Queen Elizabeth Building, Glasgow Royal Infirmary, 10 Alexandra Parade, Glasgow G31 2ER, UK 1 To whom correspondence should be addressed. e-mail: InassOsman{at}aol.com
| ABSTRACT |
|---|
|
|
|---|
Accumulating evidence suggests that human parturition represents an inflammatory process. Leukocytes are known to infiltrate uterine tissues but the exact timing, nature and quantity of these cells has not been formally characterized. We have previously demonstrated an apparent increase in pro-inflammatory cytokines within tissues of the labouring uterus. The aims of this study were to quantify and compare the leukocyte subpopulations before and during labour in fetal membranes, decidua and cervix and to quantify and compare mRNA expression of interleukin-1ß (IL-1ß), IL-6, IL-8 and tumour necrosis factor-
in myometrium, cervix, chorio-decidua and amnion. Biopsies of each of these tissues were obtained from pregnant women delivered by Caesarean section before and after the onset of spontaneous labour at term. Subpopulations of leukocytes were identified using immunohistochemistry and cytokine mRNA expression was quantified using Northern analysis. We found that parturition was associated with a significant increase in IL-1ß, IL-6 and IL-8 mRNA expression in cervix and myometrium, IL-6 and IL-8 mRNA expression in chorio-decidua and IL-1ß and IL-8 mRNA expression in amnion. Histological analysis demonstrated that leukocytes (predominantly neutrophils and macrophages) infiltrate the uterine cervix coincident with the onset of labour. These data lend further support to the hypothesis that labour is an inflammatory process. Key words: cervix/cytokines/leukocytes/labour/uterus
| Introduction |
|---|
|
|
|---|
There is mounting evidence that human parturition represents an inflammatory response (Bowen et al., 2002). We and others have shown that leukocytes infiltrate uterine tissues at or around the time of parturition. In the myometrium, there is a massive influx of macrophages, neutrophils and T-lymphocytes coincident with the onset of labour at term (Thomson et al., 1999). An influx of inflammatory cells has also been observed in decidua after the onset of labour (Keski-Nisula et al., 2000). Although neutrophils and macrophages appear to infiltrate the uterine cervix, the timing of this event differs from that in the myometrium. In the cervix, leukocytic infiltration occurs prior to the onset of labour at term, with no further influx of inflammatory cells demonstrated following the onset of labour (Bokstrom et al., 1997).
The function of the leukocytic infiltrate in the process of parturition is unclear. We have previously shown that leukocytes in the myometrium, cervix, decidua and membranes express pro-inflammatory cytokines such as interleukin-1ß (IL-1ß), IL-6 and IL-8 (Young et al., 2002). Additionally, there appears to be a greater concentration of inflammatory cells in labouring versus non-labouring tissues, although we did not formally characterize this. Others have previously shown up-regulation of pro-inflammatory cytokines in amniotic fluid and in gestational tissues in association with labour (Bowen et al., 2002). We hypothesized that expression of messenger RNA of each of the cytokines IL-1ß, IL-6, IL-8 and tumour necrosis factor (TNF-
) would be up-regulated in myometrium, cervix and fetal membranes during labour. In association with this, we also hypothesized that the cervix, fetal membranes and decidua are infiltrated by leukocytes during labour, as we have previously shown in the myometrium.
The aims of the present study were (i) to quantify and compare leukocyte subpopulations before and during labour in fetal membranes, decidua and cervix and (ii) to quantify and compare mRNA expression of IL-1ß, IL-6, IL-8 and TNF-
in myometrium, amnion, chorio-decidua and cervix before and during labour.
| Materials and methods |
|---|
|
|
|---|
Subjects
Biopsies of fetal membranes, maternal decidua, cervix and myometrium were obtained from pregnant women delivered by lower segment Caesarean section at term (>37 weeks gestation) (i) during spontaneous labour and (ii) prior to the onset of labour. Labouring women had a cervical dilatation of between 4 and 8 cm. Women with clinical evidence of infection, multiple pregnancy or dysfunctional labour and those who had received prostaglandin or artificial oxytocin were excluded. Written informed consent was obtained from each woman prior to recruitment and the study was approved by the Local Research Ethics Committee.
The cervical specimens were obtained using a scalpel from the anterior lip of the cervix via the uterine incision following delivery of the infant in the labouring group and prior to delivery from the same site per vaginam in the non-labouring group, as we have previously described (Ledingham et al., 2000). Biopsies of fetal membranes (amnion and chorio-decidua) were sampled from the rupture site (the zone of altered morphology; Malak et al., 1994) in group (i) and from the portion of fetal membranes overlying the uterine cervix in group (ii). Myometrial biopsies were obtained from the upper margin of the lower segment uterine incision during Caesarean section, as we have previously described (Thomson et al., 1999). All tissue samples were either fixed in 10% buffered formalin (BDH, Poole, UK) and embedded in paraffin or snap-frozen in liquid nitrogen and stored at 70°C for total RNA extraction.
Immunohistochemistry
Leukocytes and subpopulations of neutrophils, macrophages, B-lymphocytes and T-lymphocytes were identified using primary antibodies (Dako Ltd, Glostrup, Denmark) directed against CD45 (the common leukocyte antigen), neutrophil elastase, CD68, CD20 and CD3 (Table I) respectively in biopsies of amnion, chorio-decidua and cervix both before and during labour. The techniques used were identical to those which we have previously employed to investigate leukocyte subpopulations in myometrium (Thomson et al., 1999). Paraffin-embedded tissue sections 5 µm thick were mounted on silane-coated slides and heated to 60°C for 35 min (n = 10 for each tissue obtained prior to the onset of labour except for cervix where n = 8, and n = 10 for each tissue obtained after the onset of labour except for cervix where n = 8). Tissue sections were then deparaffinized using xylene and gradually rehydrated with ethanol. Some sections required pre-treatment to retrieve the antigen (Table I). This was done by microwaving the sections at full power for 45 min in citrate buffer (10 mmol/l, pH 6.0), or by enzymatic digestion with a 0.1% (w/v) tryspin (Sigma, Poole, Dorset, UK) solution in Tris buffer (pH 7.6) containing 0.1% (w/v) calcium chloride, for 10 min at room temperature. Preincubation was carried out with 1.5% (w/v) normal horse serum in phosphate-buffered saline (PBS; 10 mmol/l sodium phosphate, pH 7.5, 120 mmol/l sodium chloride) for 30 min at room temperature. Thereafter slides were incubated for 60 min with the primary antibody diluted in 1.5% horse serum, then washed with PBS. Further incubation was carried out with biotinylated anti-mouse immunoglobulin (Vector Laboratories, Peterborough, UK) diluted in 1.5% horse serum and 1.5% normal human serum. Sections were then washed in PBS and incubated with avidin DH/biotinylated horse-radish peroxidase H reagent (Vector) in PBS for 30 min before final washing. The antigen was localized using 1 mg/ml diaminobenzidene tetrahydrochloride (DAB; Sigma), 0.2% H2O2 in 50 mmol/l TrisHCl, pH 7.6, which appeared as a brown end-product. Sections were then counterstained with Harris haematoxylin (Sigma). Negative controls included slides incubated without the primary antibody and sections incubated with a mouse monoclonal antibody against IgG1 Aspergillus niger glucose oxidase (Dako), an enzyme that is neither present nor inducible in mammalian tissues. Tonsillar tissue was used as positive control for all antibodies used.
|
Quantification of inflammatory cell density
Following immunohistochemistry, the inflammatory cells were identified by histological analysis. The number of cell transects in ten randomly selected high power fields (x400 objective magnification) was quantified by two independent observers (I.O. and A.Y.) for each specimen. The area for each high power field was 0.23 mm2. Both observers were blinded as to whether the tissues were from a labouring or non-labouring source. Inflammatory cells within the blood vessels were not included in the counts. The median density of positive cells for each specimen was calculated. Within specimens of chorio-decidua, leukocyte subpopulations were quantified in chorion and decidua.
Northern analysis
Total RNA was extracted from amnion, chorio-decidua, cervical and myometrial samples (n = 6 in each group except for cervix where n = 4) using the Trizol® method and quantified using Northern blotting. In view of the difficulties inherent in separating chorion and decidua, these tissues were examined as a single entity, the chorio-decidua (Benirschke and Kaufmann, 1995). 10 µl of RNA sample loading buffer was added to 10 µg of total RNA and the resulting solution separated onto 1.2% agarose gels. Gels were electrophoresed at 60 V for 2.5 h. RNA was transferred and fixed by UV irradiation onto Hybond-N nylon membranes in 20xsodium saline citrate overnight. The nylon membranes were prehybridized in 12 ml of Ultrahyb (AMS Biotechnology, Oxon, UK) for 12 h at 42°C and subsequently hybridized with the DNA probes for IL-1ß, IL-6, IL-8, TNF-
and the radiolabelled probe CTP and GAPDH. DNA probes were generated from stimulated ThP1 cells by RTPCR using oligonucleotide primers. These primers were designed, and their product size and sequence validated using the GenBank database (www.nchi.nlm.nih.gov). After hybridization, the nylon membranes were washed and autoradiography was performed at 70°C for 27 days. The intensity of the bands on the autoradiographs for each of the cytokines was compared to the housekeeping gene human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and the ratio determined. Stimulated THP1 cells were used as positive controls.
RTPCR
RTPCR was performed when Northern analysis failed to detect a cytokine message. cDNA was generated from 5 µg of RNA from each of amnion, chorio-decidua, cervix and myometrium in labour (n = 3 for each tissue) and not in labour (n = 3 for each tissue) using the Superscript Preamplification System for first strand cDNA synthesis (Invitrogen, Paisley, UK). Briefly, 5 µg of RNA was made up to 11 µl with distilled water. 1 µl of Oligo (dT) was added and the sample incubated for 10 min at 70°C. 7 µl of a mix of 2 µl 10xbuffer, 2 µl 25 mmol/l MgCl2, 1 µl 10 mmol/l dNTP and 2 µl 0.1 mol/l DTT was added and incubated for 5 min at 42°C. After the addition of 1 µl Superscript II, the sample was incubated for 50 min at 42°C, then 15 min at 70°C. Finally 1 µl RNase H was added and incubated for 20 min.
The oligonucleotide PCR primers (5' ATGAGCACTGAAAGCATGATC and 3' TCACAGGGCAATGATCCCAAAGTAGACCTGCCC) used to amplify TNF-
cDNA were designed and validated (for product size and sequence) using the GenBank database (www.nchi.nlm.nih.gov). PCR was carried out on a PCR Express machine (Hybaid, Ashford, UK). Briefly 50100 ng of template DNA was amplified using 0.5 IU Taq polymerase (Advanced Biotechnologies, Surrey, UK) in 1xBuffer IV [(200 mmol/l (NH4 )2 SO4, 750 mmol/l TrisHCl pH 8.8), 0.1% (v/v) Tween 20 (Bioline, London, UK), 1.5 mmol/l MgCl2 (Bioline), 200 µmol/l dNTP (dATP, dGTP, dTTP, dCTP (Roche Diagnostics)]. 0.12 µmol/l of each primer was made up to a final volume of 12.5 µl with sterile distilled water. Incubation was at 95°C for 5 min, followed by 30 cycles of 95°C for 1 min, 56°C for 1 min and 72°C for 2 min with a final extension of 72°C for 10 min. A 10 µl aliquot of the PCR product was mixed with 5 µl of loading buffer and run out on a 2% agarose gel containing 1 µl of ethidium bromide in a horizontal gel tank in Trisacetate electrophoresis buffer with a constant current of
80 V. The samples were also amplified for the control 18S to check that first strand cDNA synthesis was successful.
Quantification of pro-inflammatory cytokines
Following Northern analysis, the autoradiograph intensity for each cytokine was compared to GAPDH and the ratio was determined using Bio-Rad Multi-Analyst/PC 1.1. The cytokine:GAPDH ratio was compared between labouring and non-labouring groups to investigate changes in mRNA expression during parturition.
Statistical analysis
Statistical differences between groups for each tissue type were explored using the KruskalWallis test for both inflammatory cell density and mRNA quantification with MannWhitney U-test as a post-hoc test for autoradiograph band intensity. Where cytokine mRNA expression and leukocyte density had been determined in biopsies from the same patient (cervical samples only), the association between mRNA concentration and leukocyte density was explored by calculating the partial correlation coefficient (adjusted for the presence or absence of labour). All statistical analyses were performed using SPSS for Windows, version 8. P < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
Cervix and myometrium
Cervical biopsies were composed mainly of cervical stroma. There was insufficient epithelial tissue, particularly after microwaving, for formal comparison of leukocyte numbers to be made in this area. Our results are therefore restricted to the cervical stroma. All inflammatory cell types were identified in labouring and non-labouring cervical stroma (Figure 1 and Table II). Total leukocyte density, and the densities of neutrophils and macrophages was greater in labouring versus non-labouring cervix.
|
|
mRNA for cytokines IL-1ß, IL-6 and IL-8 was identified in labouring and non-labouring myometrium and cervix and was significantly greater following spontaneous labour compared with non-labouring tissues (P < 0.02) (Figure 2a and b). TNF-
messenger RNA expression was not detected using Northern analysis but was weakly detected in two out of the six myometrial samples (both obtained from women in labour) and one out of the six cervical samples.
|
Within cervical tissue, there was a significant correlation between mRNA expression of each of IL-1ß, IL-6 and IL-8 and total leukocyte density, after adjusting for the presence or absence of labour [partial correlation coefficients of 0.94 (P < 0.02), 0.94 (P < 0.02) and 0.92 (P < 0.03) respectively].
Amnion and choriodecidua
As with the cervix, we were able to identify inflammatory cells in the amnion and chorio-decidua (Figure 1). The median density of leukocytes, macrophages, neutrophils, T-lymphocytes and B-lymphocytes was 1 or <1 per high powered field in the amnion and chorion with no significant differences after labour compared with before labour. Decidual cell densities are described in Table II. There were significantly greater densities of leukocytes and macrophages in the decidua compared with that in the amnion and chorion (P < 0.02). The expression of IL-1ß (P < 0.02) and IL-8 (P < 0.01) mRNA but not of IL-6 mRNA was significantly greater in amnion following spontaneous labour (Figure 2c). The expression of IL-8 (P < 0.005) and IL-6 (P < 0.05) but not IL-1ß mRNA was significantly greater in chorio-decidua (Figure 2d) following spontaneous labour. TNF-
mRNA expression was detected neither by Northern analysis nor by PCR.
| Discussion |
|---|
|
|
|---|
To our knowledge, this is the first time that peripartum pro-inflammatory events have been assessed in each of the principal tissue types in the uterus using the same experimental protocol. We have shown that the onset of parturition is associated with an increase in pro-inflammatory cytokines in myometrium, cervix, amnion and chorio-decidua. In contrast, we have observed an influx of inflammatory cells in the myometrium (Thomson et al., 1999) and cervix only, and not in the fetal membranes or decidua, in association with parturition.
In the cervix, leukocytes were sparse prior to the onset of labour, but their density increased significantly in labour in concert with increased cervical production of pro-inflammatory cytokines. Indeed, there were significant correlations between cytokine mRNA expression and leukocyte density within the cervix. In a previous study, we localized each of the pro-inflammatory cytokines to the leukocytes within the cervix, suggesting that invading leukocytes are a major source of the increase in these agents during parturition (Young et al., 2002). The work described here confirms previous data showing that the cervix is invaded by leukocytes during the process of cervical ripening and parturition (Junqueira et al., 1980; Bokstrom et al., 1997). The putative effects of these leukocytes include breakdown and remodelling of cervical tissue via release of matrix metalloproteinases, prostaglandins, cell adhesion molecules and nitric oxide (Thomson et al., 1999; Ledingham et al., 2000, 2001). The pro-inflammatory cytokines released by the leukocytes and other cell types may also contribute to this process, not least by promoting further leukocyte invasion. The work described here conflicts with previous reports in the precise timing of the leukocytic invasion (Bokstrom et al., 1997). In our study, we showed a 23-fold increase in leukocyte density in labouring compared with non-labouring tissues. However, Bokstrom et al. showed a 23-fold increase in leukocyte density from the first trimester of pregnancy to term, prior to the onset of labour. They did not observe any further increase in leukocyte density after the onset of labour. The absolute number of inflammatory cells observed in the labouring samples was similar (when corrected for the area examined) in both that study and the one described here. In our study, we did not take cervical biopsies early in pregnancy or in the non-pregnant state, and cannot therefore be certain that some leukocytic invasion occurred prior to end of pregnancy. Although our methods are apparently similar to those used by Bokstrom et al., it is possible that subtle differences in the characteristics of women recruited have contributed to the discrepant results. For example, Bokstrom et al. did not define active labour, whereas we employed strict inclusion criteria, recruiting only those women in spontaneous labour with cervical dilation of 48 cm. If the labouring women in the Bokstrom study were in early rather than established labour, an influx of inflammatory cells in their subjects in association with labour might have been masked. If the non-labouring women in our study were more distant from the spontaneous onset of labour (with a less ripe cervix) than the Bokstrom subjects, the rise in leukocyte count which we observed could have occurred in late pregnancy, rather than in labour. We are aware of only one other study which reports leukocyte density in the peripartum cervix (Junqueira et al., 1980). This study reports an increase in leukocyte density from non-pregnant cervix to those obtained during parturition (which is consistent both with our results and those of Bokstrom), although quantitative analysis was not performed.
In the myometrium, as in the cervix, parturition is associated with an increase in pro-inflammatory cytokine production, as we have demonstrated in this study, and massive leukocyte invasion, as we have demonstrated in a previous study (Thomson et al., 1999). Again, our previously reported data suggest that the invading leukocytes make a significant contribution to pro-inflammatory cytokine production. At least one of the cytokines produced, IL-1ß, is known to stimulate myometrial contractions both directly and via an increase in prostaglandin production, thus contributing to the fundamental mechanisms of parturition (Hertelendy et al., 1993; Molnar et al., 1993).
In the fetal membranes and decidua, we observed an increase in pro-inflammatory cytokine production, but failed to show a significant increase in leukocyte density, in association with the onset of labour. There was little IL-6 mRNA expression in amnion either in labour or not in labour. These data are in agreement with those showing amniochorionic IL-6 mRNA expression only when samples were obtained from infected membranes or were stimulated by endotoxin (Menon et al., 1995) whereas amniochorionic IL-6 protein expression has been more consistently identified (Laham et al., 1996; Keelan et al., 1997). In contrast to IL-6, IL-1ß was expressed in chorio-decidua before the onset of labour with no significant change after labour. The reasons for this are obscure, but suggest that IL-1ß and IL-6 may play differing roles in the chorio-decidua and amnion respectively compared with other tissues within the pregnant uterus. The lack of a change in leukocyte density in the decidua in association with labour is at odds with the results of Keski-Nisula et al., who observed a significant increase in the proportion of tissues showing inflammation after the onset of labour (7/117 specimens before compared with 7/24 specimens after labour). We did observe a trend to an increase in leukocyte cell density after the onset of labour. In retrospect, the range of leukocyte densities in this tissue was wide, and our study was therefore probably underpowered to show anything other than a huge increase in leukocyte density in the decidua.
We did not formally compare cytokine production across tissue types, as this was not the primary aim of our study. However, the cytokine mRNA production from the myometrium is at least as great (per gramme of tissue) as that from the cervix and fetal membranes. Given the signficantly greater mass of the myometrium, if protein synthesis reflects mRNA production, the myometrium will make by far the greatest contribution to pro-inflammatory cytokine production. This contrasts with data indicating that the fetal membranes play a pivotal role in the initiation of parturition via nuclear factor-kappaB activation, synthesis of cyclooxygenase 2 and production of prostaglandins (Slater et al., 1999; Allport et al., 2001). We hypothesize that the myometrium and fetal membranes play complementary roles during the process of labourthe trigger to parturition may be delivered from the fetal membranes, possibly acting on signals received from the fetus (Challis et al., 2000). Leukocyte invasion and pro-inflammatory cytokine production may then be stimulated in the myometrium in a feed forward loop which sustains and amplifies the process of parturition via prostaglandin production and uterine contractions.
In summary, we have shown that parturition is associated with leukocyte invasion and pro-inflammatory cytokine production in the cervix and myometrium. We observed a selective increase in some of the cytokines in the fetal membranes and decidua. These data support the hypothesis that labour is an inflammatory process. If similar processes occur in preterm labour, they may provide novel therapeutic targets for the treatment of this condition.
| REFERENCES |
|---|
|
|
|---|
Allport, V.C., Pieber, D., Slater, D.M., Newton, R., White, J.O. and Bennett, P.R. (2001) Human labour is associated with nuclear factor-kappaB activity which mediates cyclo-oxygenase-2 expression and is involved with the functional progesterone withdrawal. Mol. Hum. Reprod., 7, 581586.
Benirschke, K. and Kaufmann, P. (1995) Pathology of the Human Placenta, 3rd edn. Springer-Verlag, New York, pp. 268305.
Bokstrom, H., Brannstrom, M., Alexandersson, M. and Norstrom, A. (1997) Leukocyte subpopulations in the human uterine cervical stroma at early and term pregnancy. Hum. Reprod., 12, 586590.
Bowen, J.M., Chamley, L., Keelan, J.A. and Mitchell, M.D. (2002) Cytokines of the placenta and extra-placental membranes: roles and regulation during human pregnancy and parturition. Placenta, 23, 257273.[CrossRef][Web of Science][Medline]
Challis, J.R.G., Matthews, S.G., Gibb, W. and Lye, S.J. (2000) Endocrine and paracrine regulation of birth at term and preterm. Endocr. Rev., 21, 514550.
Hertelendy, F., Romero, R., Molnar, M., Todd, H. and Baldassare, J.J. (1993) Cytokine-initiated signal transduction in human myometrial cells. Am. J. Reprod. Immunol., 30, 4957.
Junqueira, L.C., Zugaib, M., Montes, G.S., Toledo, O.M., Krisztan, R.M. and Shigihara, K.M. (1980) Morphologic and histochemical evidence for the occurrence of collagenolysis and for the role of neutrophilic polymorphonuclear leukocytes during cervical dilation. Am. J. Obstet. Gynecol., 138, 273281.[Web of Science][Medline]
Keelan, J.A., Sato, T. and Mitchell, M.D. (1997) Interleukin (IL)-6 and IL-8 production by human amnion: regulation by cytokines, growth factors, glucocorticoids, phorbol esters and bacterial lipopolysaccharide. Biol. Reprod., 57, 14381444.[Abstract]
Keski-Nisula, L., Aalto, M.L., Katila, M.L. and Kirkinen, P. (2000) Intrauterine inflammation at term: a histopathologic study. Hum. Pathol., 31, 841846.[CrossRef][Web of Science][Medline]
Laham, N., Brennecke, S.P., Bendtzen, K. and Rice, G.E. (1996). Differential release of interleukin-6 from human gestational tissues in association with labour and in vitro endotoxin treatment. J. Endocrinol., 149, 431439.
Ledingham, M.A., Thomson, A.J., Young, A., Macara, L.M., Greer, I.A. and Norman, J.E. (2000) Changes in the expression of nitric oxide synthase in the human uterine cervix during pregnancy and parturition. Mol. Hum. Reprod., 6, 10411048.
Ledingham, M.A., Thomson, A.J., Jordan, F., Young, A., Crawford, M. and Norman, J.E. (2001) Cell adhesion molecule expression in the cervix and myometrium during pregnancy and parturition. Obstet. Gynecol., 97, 235242.[CrossRef][Web of Science][Medline]
Malak, T.M. and Bell, S.C. (1994) Structural characteristics of term human fetal membranes: a novel zone of extreme morphological alteration within the rupture site. Br. J. Obstet. Gynecol., 101, 375386.[Web of Science][Medline]
Menon, R., Swan, K. Lyden, T.W., Rote, N.S. and Fortunato, S.J. (1995) Expression of inflammatory cytokines (interleukin-1ß) and interleukin-6 in amniochorionic membranes. Am. J. Obstet. Gynecol., 172, 493500.[CrossRef][Web of Science][Medline]
Molnar, M., Romero, R. and Hertelendy, F. (1993) Interleukin-1 and tumor necrosis factor stimulate arachidonic acid release and phospholipid metabolism in human myometrial cells. Am. J. Obstet. Gynecol., 169, 825829.[Web of Science][Medline]
Slater, D.M., Dennes, W.J., Campa, J.S., Poston, L. and Bennett, P.R. (1999) Expression of cyclo-oxygenase types-1 and 2 in human myometrium throughout pregnancy. Mol. Hum. Reprod., 5, 880884.
Thomson, A.J., Telfer, J.F., Young, A., Campbell, S., Stewart, C.J., Cameron, I.T., Greer, I.A. and Norman, J.E. (1999) Leukocytes infiltrate the myometrium during human parturition: further evidence that labour is an inflammatory process. Hum. Reprod., 14, 229236.
Young, A., Thomson, A.J., Ledingham, M., Jordan, F., Greer, I.A. and Norman, J.E. (2002) Immunolocalization of proinflammatory cytokines in myometrium, cervix and fetal membranes during human parturition at term. Biol. Reprod., 66, 445449.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. J. Stock, L. Duthie, T. Tremaine, A. A. Calder, R. W. Kelly, and S. C. Riley Elafin (SKALP/Trappin-2/proteinase inhibitor-3) Is Produced by the Cervix in Pregnancy and Cervicovaginal Levels Are Diminished in Bacterial Vaginosis Reproductive Sciences, December 1, 2009; 16(12): 1125 - 1134. [Abstract] [PDF] |
||||
![]() |
H. N Jabbour, K. J Sales, R. D Catalano, and J. E Norman Inflammatory pathways in female reproductive health and disease Reproduction, December 1, 2009; 138(6): 903 - 919. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yuan, F. Jordan, I.B. McInnes, M.M. Harnett, and J.E. Norman Leukocytes are primed in peripheral blood for activation during term and preterm labour Mol. Hum. Reprod., November 1, 2009; 15(11): 713 - 724. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Youssef, M. A. Ledingham, S. S. Bollapragada, N. O'Gorman, F. Jordan, A. Young, and J. E. Norman The Role of Toll-Like Receptors (TLR-2 and -4) and Triggering Receptor Expressed on Myeloid Cells 1 (TREM-1) in Human Term and Preterm Labor Reproductive Sciences, September 1, 2009; 16(9): 843 - 856. [Abstract] [PDF] |
||||
![]() |
B. F. Mitchell and M. J. Taggart Are animal models relevant to key aspects of human parturition? Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2009; 297(3): R525 - R545. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Mendelson Minireview: Fetal-Maternal Hormonal Signaling in Pregnancy and Labor Mol. Endocrinol., July 1, 2009; 23(7): 947 - 954. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W Boyd, T. J Lechuga, C. A Ebner, M. A Kirby, and S. M Yellon Cervix remodeling and parturition in the rat: lack of a role for hypogastric innervation Reproduction, April 1, 2009; 137(4): 739 - 748. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. de la Torre, M. J. Mulla, A. G. Yu, S.-J. Lee, P. B. Kavathas, and V. M. Abrahams Chlamydia trachomatis Infection Modulates Trophoblast Cytokine/Chemokine Production J. Immunol., March 15, 2009; 182(6): 3735 - 3745. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Timmons, A.-M. Fairhurst, and M. S. Mahendroo Temporal Changes in Myeloid Cells in the Cervix during Pregnancy and Parturition J. Immunol., March 1, 2009; 182(5): 2700 - 2707. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Challis, C. J. Lockwood, L. Myatt, J. E. Norman, J. F. Strauss III, and F. Petraglia Inflammation and Pregnancy Reproductive Sciences, February 1, 2009; 16(2): 206 - 215. [Abstract] [PDF] |
||||
![]() |
A. L. Tarca, S. Draghici, P. Khatri, S. S. Hassan, P. Mittal, J.-s. Kim, C. J. Kim, J. P. Kusanovic, and R. Romero A novel signaling pathway impact analysis Bioinformatics, January 1, 2009; 25(1): 75 - 82. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Shynlova, P. Tsui, A. Dorogin, and S. J. Lye Monocyte Chemoattractant Protein-1 (CCL-2) Integrates Mechanical and Endocrine Signals That Mediate Term and Preterm Labor J. Immunol., July 15, 2008; 181(2): 1470 - 1479. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. O'Brien, J. J. Morrison, and T. J. Smith Upregulation of PSCDBP, TLR2, TWIST1, FLJ35382, EDNRB, and RGS12 Gene Expression in Human Myometrium at Labor Reproductive Sciences, April 1, 2008; 15(4): 382 - 393. [Abstract] [PDF] |
||||
![]() |
M. Tattersall, N. Engineer, S. Khanjani, S. R Sooranna, V. H Roberts, P. L Grigsby, Z. Liang, L. Myatt, and M. R Johnson Pro-labour myometrial gene expression: are preterm labour and term labour the same? Reproduction, April 1, 2008; 135(4): 569 - 579. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Yellon, C. A. Ebner, and Y. Sugimoto Parturition and Recruitment of Macrophages in Cervix of Mice Lacking the Prostaglandin F Receptor Biol Reprod, March 1, 2008; 78(3): 438 - 444. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Timmons and M. Mahendroo Processes Regulating Cervical Ripening Differ From Cervical Dilation and Postpartum Repair: Insights From Gene Expression Studies Reproductive Sciences, December 1, 2007; 14(8_suppl): 53 - 62. [Abstract] [PDF] |
||||
![]() |
D. Stygar, B. Masironi, H. Eriksson, and L. Sahlin Studies on estrogen receptor (ER) {alpha} and {beta} responses on gene regulation in peripheral blood leukocytes in vivo using selective ER agonists J. Endocrinol., July 1, 2007; 194(1): 101 - 119. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-J. Leroy, E. Dallot, I. Czerkiewicz, T. Schmitz, and M. Breuiller-Fouche Inflammation of Choriodecidua Induces Tumor Necrosis Factor Alpha-Mediated Apoptosis of Human Myometrial Cells Biol Reprod, May 1, 2007; 76(5): 769 - 776. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Smith Parturition N. Engl. J. Med., January 18, 2007; 356(3): 271 - 283. [Full Text] [PDF] |
||||
![]() |
S. Astle, R. Newton, S. Thornton, M. Vatish, and D.M. Slater Expression and regulation of prostaglandin E synthase isoforms in human myometrium with labour Mol. Hum. Reprod., January 1, 2007; 13(1): 69 - 75. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Soloff, M. G. Izban, D. L. Cook Jr, Y.-J. Jeng, and R. C. Mifflin Interleukin-1-induced NF-{kappa}B recruitment to the oxytocin receptor gene inhibits RNA polymerase II-promoter interactions in cultured human myometrial cells Mol. Hum. Reprod., October 1, 2006; 12(10): 619 - 624. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.R. Sooranna, P.L. Grigsby, N. Engineer, Z. Liang, K. Sun, L. Myatt, and M.R. Johnson Myometrial prostaglandin E2 synthetic enzyme mRNA expression: spatial and temporal variations with pregnancy and labour Mol. Hum. Reprod., October 1, 2006; 12(10): 625 - 631. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Breuiller-Fouche and G. Germain Gene and protein expression in the myometrium in pregnancy and labor. Reproduction, May 1, 2006; 131(5): 837 - 850. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Osman, A. Young, F. Jordan, I. A. Greer, and J. E. Norman Leukocyte Density and Proinflammatory Mediator Expression in Regional Human Fetal Membranes and Decidua Before and During Labot at Term Reproductive Sciences, February 1, 2006; 13(2): 97 - 103. [Abstract] [PDF] |
||||
![]() |
D. M. Slater, S. Astle, N. Woodcock, J. E. Chivers, N. C.J. de Wit, S. Thornton, M. Vatish, and R. Newton Anti-inflammatory and relaxatory effects of prostaglandin E2 in myometrial smooth muscle Mol. Hum. Reprod., February 1, 2006; 12(2): 89 - 97. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Timmons and M. S. Mahendroo Timing of Neutrophil Activation and Expression of Proinflammatory Markers Do Not Support a Role for Neutrophils in Cervical Ripening in the Mouse Biol Reprod, February 1, 2006; 74(2): 236 - 245. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Kirby, M. A. Kirby, J. W. Warren, L. T Tran, and S. M. Yellon Increased Innervation and Ripening of the Prepartum Murine Cervix Reproductive Sciences, December 1, 2005; 12(8): 578 - 585. [Abstract] [PDF] |
||||
![]() |
T. M Lindstrom and P. R Bennett The role of nuclear factor kappa B in human labour Reproduction, November 1, 2005; 130(5): 569 - 581. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Shankar, N. Gude, F. Cullinane, S. Brennecke, A. W Purcell, and E. K Moses An emerging role for comprehensive proteome analysis in human pregnancy research Reproduction, June 1, 2005; 129(6): 685 - 696. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Sooranna, N. Engineer, J. A. Z. Loudon, V. Terzidou, P. R. Bennett, and M. R. Johnson The Mitogen-Activated Protein Kinase Dependent Expression of Prostaglandin H Synthase-2 and Interleukin-8 Messenger Ribonucleic Acid by Myometrial Cells: The Differential Effect of Stretch and Interleukin-1{beta} J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3517 - 3527. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hirsch and H. Wang The Molecular Pathophysiology of Bacterially Induced Preterm Labor: Insights From the Murine Model Reproductive Sciences, April 1, 2005; 12(3): 145 - 155. [Abstract] [PDF] |
||||
![]() |
J. Bailey, A. J Tyson-Capper, K. Gilmore, S. C Robson, and G N. Europe-Finner Identification of human myometrial target genes of the cAMP pathway: the role of cAMP-response element binding (CREB) and modulator (CREM{alpha} and CREM{tau}2{alpha}) proteins J. Mol. Endocrinol., February 1, 2005; 34(1): 1 - 17. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Farina and C. Winkelman A Review of the Role of Proinflammatory Cytokines in Labor and Noninfectious Preterm Labor Biol Res Nurs, January 1, 2005; 6(3): 230 - 238. [Abstract] [PDF] |
||||
![]() |
M. Thompson, H. Barata da Silva, W. Zielinska, T. A. White, J. P. Bailey, F. E. Lund, G. C. Sieck, and E. N. Chini Role of CD38 in myometrial Ca2+ transients: modulation by progesterone Am J Physiol Endocrinol Metab, December 1, 2004; 287(6): E1142 - E1148. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dalrymple, D. M. Slater, L. Poston, and R. M. Tribe Physiological Induction of Transient Receptor Potential Canonical Proteins, Calcium Entry Channels, in Human Myometrium: Influence of Pregnancy, Labor, and Interleukin-1{beta} J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1291 - 1300. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Barata, M. Thompson, W. Zielinska, Y. S. Han, C. B. Mantilla, Y. S. Prakash, S. Feitoza, G. Sieck, and E. N. Chini The Role of Cyclic-ADP-Ribose-Signaling Pathway in Oxytocin-Induced Ca2+ Transients in Human Myometrium Cells Endocrinology, February 1, 2004; 145(2): 881 - 889. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

















