Molecular Human Reproduction, Vol. 9, No. 8, 449-455,
August 2003
© 2003 European Society of Human Reproduction and Embryology
Article |
Expression of fractalkine in the rat testis: molecular cloning of a novel alternative transcript of its gene that is differentially regulated by pro-inflammatory cytokines
Submitted on September 13, 2002; resubmitted on January 30, 2003. accepted on April 14, 2003
INSERM U. 435-GERM, Université de Rennes I, Campus de Beaulieu, 35042 Rennes cedex, Bretagne, France
1 To whom correspondence should be addressed. e-mail: michel.samson{at}rennes.inserm.fr
| ABSTRACT |
|---|
|
|
|---|
The testis is a very complex organ in which cellular communications and interactions are central to spermatogenesis and where inflammatory processes can lead to sterility. Fractalkine (CX3CL1) is a chemokine involved in cellcell interactions and in leukocyte chemoattraction. It has been reported to be expressed in testis, but its cellular expression and function in this organ has not been described. In this study we report constitutive expression of fractalkine in the testis. Expression is higher in Leydig cells than Sertoli cells, spermatogonia, pachytene spermatocytes and elongated spermatids. In both, Sertoli cells stimulated by interleukin-1ß and tumour necrosis factor
, and in Leydig cells, two forms of fractalkine mRNA were observed: the previously described transcript of 3.7 kb and a novel transcript of 4.2 kb. The 4.2 kb transcript has a 5' elongation and is differentially regulated. To investigate fractalkine function in testis, we abolished Leydig cell expression of fractalkine by specific destruction of this cell type using ethylene dimethane sulphonate. The absence of fractalkine expression in Leydig cells did not seem to affect the fractalkine expression by other testicular cells. In addition, the destruction of testicular macrophages by Cl2MDP (chlodronate) did not seem to affect Leydig cell expression of fractalkine. We conclude that Leydig cell expression of fractalkine could be preferentially involved in inflammation in interstitial space whereas fractalkine expressed by germ cells may participate in the cellular interactions between germ cells and other seminiferous tubule cell types. Key words: chemokine/CX3CL1/fractalkine/testis
| Introduction |
|---|
|
|
|---|
Fractalkine (CX3CL1) is a chemokine involved in cellcell interactions and leukocyte chemoattraction (Bazan et al., 1997; Pan et al., 1997; Harrison et al., 1998). Fractalkine has been reported to be expressed constitutively in various tissues including brain, kidney, lung, heart, skeletal muscle and testis (Rossi et al., 1998). The testis contains fractalkine mRNA as assessed by Northern blot analysis (Bazan et al., 1997; Rossi et al., 1998). However, no investigation of fractalkine protein production or its function in the testis has been reported.
The testis is a very complex organ where both cellular communication and interaction contribute to the control of testosterone production and spermatogenesis (Jégou and Sharpe, 1993; Sharpe et al., 1995). Testicular inflammation, named orchitis, can lead to sterility, and appears to be associated with leukocyte infiltration most probably related to chemokine production. Fractalkine is a membrane-anchored chemokine with an O-glycosylated mucine-like stalk mediating firm adhesion. It has a soluble protein domain displaying chemotactic properties. It is therefore possible that fractalkine is involved in testicular interactions and communications, and in the recruitment of leukocytes during orchitis. Consistent with this hypothesis, several studies report the induction of fractalkine mRNA and protein by injurious stimuli, tumour necrosis factor
(TNF
), interleukin-1ß (IL-1ß) or lipopolysaccharide (LPS) (Bazan et al., 1997; Harrison et al., 1998; Maciejewski-Lenoir et al., 1999).
We have previously demonstrated that the testis produces the chemokines monocyte chemoattractant protein-1 (MCP-1), growth-related protein (GRO) and interferon
-inducible protein (IP-10) under pathological conditions (Aubry et al., 2000a,b) and that these chemokines might be involved in the accumulation of leukocytes in the testicular interstitial space observed during orchitis (Veijola and Rajaniemi, 1989; Itoh et al., 1995). Here, we report a study of the cellular expression of fractalkine under basal conditions, during exposure to various pro-inflammatory agents, and an investigation of the potential role of fractalkine in male reproductive function.
| Materials and methods |
|---|
|
|
|---|
Animals
Male SpragueDawley rats were purchased from Elevage Janvier (France). All experimental and surgical procedures involving animals were approved by the veterinary office of the Ministry of Agriculture, France.
Preparation and culture of Sertoli cells
The isolation and culture of the Sertoli cells from 20-day-old rats was carried out as described by Toebosch et al. (1989) and Pineau et al. (1991). The cells were seeded at 1.5x106 cells/ml in Hams F-12/Dulbeccos minimum essential medium (DMEM) (vol/vol) (Life Technologies, France) supplemented with insulin (10 µg/ml), transferrin (5 µg/ml), gentamycin (50 µg/ml) (Life Technologies) and 10% fetal calf serum (FCS) (Costar-Polylabo, France), and incubated at 32°C in a humidified atmosphere with 5% CO2 and 95% air. On day 7 of culture, Sertoli cell cultures containing <2% germ cells and peritubular cells were used either as controls or exposed to various agents.
Preparation and culture of peritubular cells
Peritubular cells were isolated from 20-day-old rats, according to the method described by Skinner and Fritz (1985). The cells were cultured at 32°C in Hams F-12/DMEM supplemented with 10% FCS and became confluent after 7 days of culture. After only 3 days in culture, with daily changes of media, purity of these cells was
96%, as assessed by the alkaline phosphatase method (Chapin et al., 1987). No contamination by Leydig cells or macrophages could be detected by 3ß-hydroxysteroid dehydrogenase (3ß-HSD) staining (Steinberger et al., 1966) and immunocytochemistry using an ED2 antibody that detects an antigen specific for macrophages respectively (Serotec-Argene, France). These peritubular cells were then passaged once and, at confluence, they were washed with culture medium and used either as controls or exposed to various agents.
Preparation and culture of Leydig cells
Cell suspensions highly enriched for Leydig cells were prepared from adult testes of 90-day-old rats according to the multi-step isolation method of Klinefelter et al. (1987). This procedure involves the use of testicular perfusion, enzymatic dispersion, centrifugal elutriation, and Percoll density gradient centrifugation. After centrifugation, the Percoll gradient was divided into a fraction lighter than 1.068 g/ml that contained germ cells, macrophages and damaged Leydig cells, and a fraction heavier than 1.068 g/ml that contained intact and steroidogenically active Leydig cells. At this stage, the purity of the Leydig cells was ≥94%, as assessed by 3ß-HSD staining of the cells. Contaminants were mainly testicular macrophages (<4%), peritubular cells (
0.5%), and very few Sertoli and germ cells. Rat Leydig cells were cultured for 24 h at 32°C in Hams F-12/DMEM (vol/vol) supplemented with gentamycin (50 µg/ml), 0.1% BSA (Biosepra, France), and 10% FCS. After 12 h of culture, the cells were either used as controls or exposed to various agents.
Preparation of spermatogonia
The isolation and culture of spermatogonia from 9-day-old rats was carried out as described by Bellvé et al. (1977), with the minor modifications introduced by Dym et al. (1995). This procedure involved the use of enzymatic dispersion then filtration through 80 and 40 µm nylon mesh. Cells from the dissociated seminiferous tubules were separated by sedimentation velocity at unit gravity at 4°C using a 24% bovine BSA gradient in Hams F-12/DMEM. The cell suspension was bottom-loaded into an SP-120 chamber in 30 ml of Hams F-12/DMEM containing 0.5% BSA and a gradient was simutaneously generated using 275 ml each of medium supplemented with 2 and 4% BSA respectively. The cells were allowed to sediment for a standard period of 2.5 h and 300 ml were then collected from the bottom of the gradient and centrifuged at 100 g for 10 min. Cell pellets were then resuspended in Hams F-12/DMEM supplemented with gentamycin (50 µg/ml) and 10% FCS and incubated at a density of 2.5x106/ml in a humidified atmosphere of 5% CO2-95% air. After 2 h of culture, contaminating cells had attached to the culture plate and non-adherent spermatogonia were collected and used for RNA extraction.
Preparation of pachytene spermatocytes and early spermatids
Post-mitotic germ cell preparations were obtained from 90-day-old rats testes by mechanical dissociation (Pineau et al., 1993). These cells were separated by centrifugal elutriation into two populations: primary spermatocytes and early spermatids. Flow rate and/or rotor speed were changed progressively, as described by Pineau et al. (1993). Cell viability was evaluated by Trypan Blue exclusion and was found to be ≥95%. Pachytene spermatocytes and early spermatid fractions were
90% pure (Pineau et al., 1993). The enriched fractions were used for RNA extraction.
Stimulation of cultures
To determine whether Sertoli cells express fractalkine, confluent cells were incubated for 8 h with either 100 IU/ml recombinant rat IFN
(Biosource-Clinisciences, France), 100 IU/ml recombinant rat IFN
(Biosource-Clinisciences), 20 ng/ml recombinant human TNF
(R&D Systems, UK), 1 µg/ml Salmonella typhimurium LPS (Sigma), 1 ng/ml recombinant human IL-1
(R&D Systems), 10 ng/ml recombinant human IL-6 (R&D Systems) or 1 ng/ml recombinant human IL-1ß (R&D Systems).
RNA analyses
After harvesting, the isolated cells were dried and stored at 20°C until RNA extraction. The RNeasy kit (Qiagen GmbH, France) was used to isolate total RNA. For Northern blot analysis, total RNA samples (10 µg per lane) were separated on a 1% agarose gel and transferred onto Hybond N membranes (Amersham, France), as previously described (Sambrook et al., 1989). Probes were
32P-labelled by random priming (Feinberg and Vogelstein, 1983) and used for blot hybridization. The quality of RNA preparation and equal loading of gels were assessed by hybridization with a ß-actin probe. Signals were measured using molecular analyst/gel doc 1000 software (Bio-rad Laboratory, France).
The nucleotide sequences of both strands of the probes (prepared by PCR) for Northern blot analysis were verified by dye nucleotide cycle sequencing with a 373A DNA sequencer (Applied Biosystems, USA).
Rapid amplification of the cDNA 5' end
The 5' region of the fractalkine transcript was obtained by rapid amplification of the cDNA 5' ends (5' RACE) using a 5' RACE kit (Gibco BRL, France) as follows. A fractalkine gene-specific primer (GSP) 1 designed from a cDNA sequence (GenBank accession number AF030358) (5' oligomer: GGCAAG CGCGCCATCATCCTGGAG) was used for first strand cDNA synthesis from the total RNA isolated from the Sertoli cells of 20 day old SpragueDawley rats. A TdT tail was ligated to the cDNA, and it was used as the template for PCR amplification with a GSP2 (5' oligomer: CTGCTGGCGGGTCA GCACCTCGGC)/abridged anchor primer set. The PCR products were then used as templates for a PCR amplification with GSP3 (5' oligomer: CTGCTGCGCCTGGCCGCGTTCTTT)/universal amplification primer set. The 5' RACE products were inserted into pCR®2.1-TOPO (kit TOPO TA Cloning; Invitrogen, The Netherlands) and sequenced on both strands using a 373A DNA sequencer from Applied Biosystems.
SDSPAGE and immunoblotting
SDSPAGE was carried out on 12.5% polycrylamide gels. Twenty-five µg of protein of crude extracts from Sertoli cells, peritubular cells, testicular resident macrophages, Leydig cells, spermatogonia, pachytene spermatocytes and round spermatids were electrophoresed at 70 and 100 V in an electrophoresis buffer containing 0.025 mmol/l Tris, 192 mmol/l glycine, 1% SDS, pH 8.3. The gels were washed for 20 min in Towbin buffer II (10 mmol/l Tris, 96 mmol/l glycine, 0.005% SDS, 20% methanol), and the proteins transferred to Immunobilon-PSQ (PVDF) membranes (0.1 µm pore size) in a MilliblotTM-Graphite Electroblotter System (Millipore, SA, France) for 90 min at 35 mA, according to the method of Towbin et al. (1992). The membranes were blocked overnight at 4°C in 0.05 mol/l Tris-buffered saline (TBS) supplemented with 5% BSA. After washing with TBS, the membranes were incubated for 2 h at room temperature with a goat polyclonal antibody against fractalkine (working dilution: 1:100; Santa Cruz Biotechnology, USA), in TBS supplemented with 0.1% Tween and 1% BSA. Control experiments were performed by preabsorbing the antibody with a synthetic peptide (sc 7225 P; Santa Cruz) corresponding to the carboxy terminus of human fractalkine. After three further washes in TBS0.1% Tween, the membranes were incubated with anti-goat horse-radish peroxidase (Jackson Laboratory, France) at 1:10 000. After further washes in TBS0.1% Tween, ECL Western blotting detection reagents (ECLTM; Amersham Pharmacia Biotech, France) and 15 min exposure to Kodak Biomax films were used to reveal bound antibody.
In-vivo depletion of testicular macrophages and Leydig cells
A 26 gauge needle was used to inject the testis, of each anaesthetized rat, with 150 µl of liposome-entrapped PBS (control group) or liposome-entrapped chlodronate, a macrophage toxin (CL2MDP) (treated group), prepared as described and used elsewhere (Van Rooijen, 1989; Bergh et al., 1993). Seven days after this treatment, ethylene dimethane sulphonate (EDS), a Leydig cell toxicant, was dissolved in dimethylsulphoxide (DMSO):water (1:3, v/v) and administered as a single peritoneal injection to the pretreated rats (75 mg/kg) (Morris et al., 1986). Control animals (preinjected with PBS) were injected with vehicle alone (control group) or with EDS (treated group). CL2MDP pretreated animals (treated group) were injected with DMSO (control group). Seven days after this second treatment, the rats were killed, testes dissected out and prepared for immunohistochemical analysis.
Immunohistochemistry
Rat testes were fixed in 4% formaldehyde solution, dehydrated with a series of concentrations of alcohol and embedded in paraffin wax. Tissue sections (6 µm) were deparaffinized and rehydrated. The sections were incubated for 5 min in 3% H2O2 to block endogenous peroxidase activity, rinsed in TBS and incubated twice for 10 min in TBS supplemented with 1% BSA to block non-specific sites. The tissue sections were incubated overnight at 4°C with either (i) the first goat polyclonal antibody against fractalkine (sc 7225; Santa Cruz) used at 2 µg/ml or (ii) monoclonal antibody against ED1 (20 µg/ml; Biosource International, USA), or (iii) anti-ED2 monoclonal antibody (2 µg/ml; Serotec, UK). Goat IgG (Sigma, USA) or mouse IgG (Dako, France), were used at the same concentration as the antibodies, as negative controls. To confirm the specificity of the immunolocalisation of the fractalkine, control experiments were performed by preabsorbing the antibody with a synthetic peptide (sc 7225 P; Santa Cruz) corresponding to the carboxy terminus of human fractalkine. All subsequent steps were performed at room temperature. After two washes with TBS, the sections were incubated for 30 min with a biotinylated second antibody against goat IgG (1.2 µg/ml; Jackson Immunoresearch Laboratories, USA), or against mouse IgG (1 µg/ml; Dako). The sections were then rinsed again with TBS and incubated for 30 min with peroxidase-conjugated streptavidin (1:500 dilution; Dako). After a final wash with TBS, the sections were incubated with 3,3' diaminobenzidine (DAB) substrate (Dako) for 510 min, to reveal specific staining. The cell nuclei were counterstained with Hemalun Masson solution. The sections were photographed using an Olympus AX60TF microscope with monochromatic objectives (Olympus, France), coupled to a digital macro camera (Kigamo, France).
| Results |
|---|
|
|
|---|
Fractalkine mRNA expression in rat testicular cells
We determined the distribution of fractalkine mRNA by Northern blot analysis of samples prepared from isolated Leydig cells, testicular macrophages, Sertoli cells, peritubular cells, spermatogonia, pachytene spermatocytes and early spermatids. There was no fractalkine mRNA in testicular macrophages, peritubular cells, early spermatids or pachytene spermatocytes. One fractalkine mRNA transcript of 3.7 kilobases (kb) was detected in Sertoli cells and in spermatogonia, and two fractalkine transcripts of 3.7 and 4.2 kb were detected in Leydig cells (Figure 1). The highest expression of fractalkine mRNA was observed by Leydig cells, followed by spermatogonia and then by Sertoli cells.
|
Effects of inflammatory cytokines on the expression of fractalkine transcripts
We then evaluated the induction of fractalkine transcripts in Sertoli cells and spermatogonia when these cells were cultured in the presence or absence of inflammatory cytokines or of bacterial LPS. IFN
and LPS had no effect on the Sertoli cell 3.7 kb fractalkine transcript. However, it was consistently weakly induced by IL-1
, IL-1ß and IL-6, and strongly induced by IFN
and TNF
(Figure 2A). A Sertoli cell 4.2 kb fractalkine transcript was consistently observed in Sertoli cells exposed to INF
or IL-1
and it was very strongly induced by the presence of TNF
or IL-1ß (Figure 2A), but it was not detected when these cells were exposed to IFN
and LPS or under control conditions.
|
TNF
was the strongest inducer, of this 4.2 kb mRNA, among the cytokines tested and was therefore used in kinetic and doseresponse studies. In Sertoli cells, the 3.7 kb mRNA was induced within 1 h of the addition of TNF
to the culture, whereas the 4.2 kb mRNA first became detectable after 2 h (Figure 2B). Maximal abundance of the two transcripts was observed at 8 h. Fractalkine mRNA induction was dependent on the concentration of TNF
added to Sertoli cells. The lowest concentration inducing the 3.7 kb transcript was 0.02 ng/ml TNF
and the 4.2 kb transcript was 0.2 ng/ml; both transcripts were maximally stimulated by 2 ng/ml TNF
. No effect was observed when spermatogonia were exposed to the same pro-inflammatory cytokines or LPS (data not shown).
Cloning of the 5' end of the 4.2 kb fractalkine transcript
The 5' end of the 4.2 kb fractalkine mRNA was obtained from total mRNA isolated from Sertoli cells exposed to optimal conditions of TNF
, using the rapid amplification of the cDNA 5' ends (RACE) approach. No differential transcript was observed either in the coding sequence or in the 3' region (data not shown). In contrast, two distinct PCR products differing in size by 322 bp were obtained using 5' RACE (Figure 3A). The sequence of these two PCR products is presented in Figure 3A. The PCR product corresponding to the 5' sequence was used as a probe to characterize the expression of the 4.2 kb fractalkine transcript. Northern blots used to study the kinetics of expression of fractalkine transcripts in Sertoli cells when stimulated by TNF
and IL-6, or without stimulation (control), were labelled with probes chosen from the coding sequence or the 5' region of the 4.2 kb transcript. The coding region probe revealed the presence of both the 3.7 and 4.2 kb transcripts when Sertoli cells were exposed to TNF
. In contrast, only the 3.7 kb transcript was detected when the Sertoli cells were exposed to IL-6. The probe corresponding to the 5' region of the 4.2 kb transcript revealed only the 4.2 kb transcript when the Sertoli cells were stimulated by TNF
and nothing when these cells were exposed to IL-6 (Figure 3B). Neither of these probes gave a signal in control cells (Figure 3B).
|
Expression of fractalkine protein in rat testicular cells
The presence of fractalkine protein was investigated by Western blot analysis. Total protein from isolated Leydig cells, testicular macrophages, Sertoli cells, peritubular cells, spermatogonia, pachytene spermatocytes and early spermatides was tested with a polyclonal antibody (sc 7225 from Santa Cruz), recognizing the C-terminal 20 amino acids of fractalkine. Fractalkine was present in Sertoli cells, Leydig cells and in spermatogonia. The protein was detected in smaller amounts in pachytene spermatocytes and peritubular cells, and was absent from early spermatids and macrophages (Figure 4). The presence of blocking peptide in Leydig cell samples abolished the signal confirming the specificity of the assay (Figure 4).
|
Immunohistochemical localization of fractalkine within the rat testis
The polyclonal antibody sc 7225 was used to determine the cellular distribution of fractalkine within adult rat testis. In the adult rat seminiferous tubules, fractalkine was weakly labelled in pachytene spermatocytes (Figure 5A versus C) and strongly labelled in Leydig cells (Figure 5A and B versus C). The labelling was always localized in the cell cytoplasm. Addition of the blocking peptide (Figure 5 C) resulted in labelling similar to that of control IgG (data not shown) confirming specificity. The ontogenesis of fractalkine was studied using testicular sections from 2-day-old (immature) and 20-day-old (prepubertal) rats. In 2-day-old rats labelling was only observed in precursor Leydig cells (Figure 5D). Specific labelling was also observed in both Leydig cells and in pachytene spermatocytes from prepubertal rats (Figure 5E).
|
Expression of fractalkine in rat testis treated with specific toxic drugs of Leydig cells and testicular macrophages
To investigate the role of fractalkine in testis, Leydig cells and testicular macrophages were perturbed in vivo using specific toxic drugs: EDS for Leydig cells and Cl2MDP for testicular macrophages. Sections of testis were prepared for immunohistochemical studies using polyclonal antibodies directed against ED1, a marker for newly infiltrated circulating macrophages (Dijkstra et al., 1985), against ED2, a marker of resident macrophages from non-lymphoid tissues (Dijkstra et al., 1985) and against fractalkine. Under control conditions, Leydig cells and pachytene spermatocytes were labelled by the fractalkine antibody (Figure 6A), and testicular macrophages by the ED1 and ED2 antibodies (Figure 6B and C respectively). In EDS-treated rat testis, in which Leydig cells had been destroyed, no labelling was observed within the interstitial compartment although germ cell labelling persisted (Figure 6D). Testicular macrophages were still labelled by ED1 and ED2 antibodies (Figure 6E and F). In contrast, when rat testis was treated with the macrophage toxin Cl2MDP, fractalkine labelling in Leydig cells and germ cells was maintained (Figure 6G), but no ED1- or ED2-positive testicular macrophages were detected (Figure 6H and I).
|
| Discussion |
|---|
|
|
|---|
Fractalkine mRNA has previously been reported in testis, following work with commercial tissue blots (Bazan et al., 1997; Rossi et al., 1998). Fractalkine is an unusual chemokine that can be involved in both cellular interactions and chemoattraction, both phenomena highly relevant to testicular physiology and physiopathology. We therefore studied the cellular expression of fractalkine in the testis.
Both fractalkine mRNA and protein are constitutively expressed within the testis. Constitutive expression has previously been reported in brain, kidney, lung and heart (Rossi et al., 1998). In the testis, Leydig cells, Sertoli cells and spermatogonia expressed fractalkine mRNA. The corresponding protein was found in the same cells, but also in pachytene spermatocytes. The fact that the fractalkine mRNA was not detected in pachytene spermatocytes and elongated spermatids could be due to translation of the messenger earlier within the spermatogonia or within the leptotene or zygotene spermatocytes as has been reported for other proteins (Walker et al., 1999). The signal observed in the residual bodies by immunohistology has not been considered as specific as the residual bodies are known to bind immunoglobulin without specificity. The apparent molecular weight of testicular fractalkine of 30 kDa was unexpected, and inconsistent with other studies (Chapman et al., 2000; Muehlhoefer et al., 2000). However, this finding was confirmed using two different antibodies, and the Western blot signal was specific: it was abolished when the antibody was preincubated with recombinant peptide corresponding to the C-terminal 20 amino acids of fractalkine. Presumably, this 30 kDa species was a degradation product of the full length protein. A discrepancy in Sertoli cell expression of fractalkine has been observed between Western blot analysis and immunohistochemistry. Western blot analysis showed a specific signal whereas immunohistochemical analysis did not. This could be due to dilution of fractalkine to undetectable levels by immunohistochemistry in the Sertoli cell which has a volume 56-fold higher than Leydig cells or spermatogonia. Another reason could be a difference in accessibility of the polyclonal antibody to its epitope between the two techniques. Nevertheless, basal expression of fractalkine has been detected in isolated and cultured Sertoli cell populations by immunohistochemistry, confirming that this cell type does express fractalkine protein (data not shown).
In contrast to a series of other chemokines such as MCP-1, IP-10 and GRO which are expressed only by Sertoli cells, peritubular cells, testicular macrophages and Leydig cells (Hu et al., 1998; Aubry et al., 2000a,b), fractalkine was found to be expressed both in somatic and germ cells. This is consistent with the hypothesis that fractalkine could be involved in cellular interactions within the testis and may participate in cellcell adhesion between germ cells and Sertoli cells (Jégou, 1993). Indeed, the structure of fractalkine comprises a chemokine domain attached to a membrane-associated mucin-like stalk containing 17 degenerate mucin-like repeats. Thus, the role of chemokine-on-a-stick promoting cellcell interactions has been suggested (Schall, 1997).
Fractalkine was most abundant in Leydig cells and was already detectable in precursor Leydig cells. As Leydig cells are intimately connected with testicular resident macrophages (Hales, 1996; Hutson, 1998), fractalkine may participate in the interaction between Leydig cells and resident macrophages. Indeed, this has been suggested in brain where neurons expressing fractalkine might communicate with glial cells, via this ligandreceptor pair (Harrison et al., 1998; Maciejewski-Lenoir et al., 1999). Future studies investigating expression of fractalkine receptor by testicular macrophages are needed to validate our hypothesis.
Leukocytes are recruited during inflammation of the testis and fractalkine could be involved in this phenomenon as demonstrated for other chemokines (Aubry et al., 2000a,b). In Sertoli cells stimulated by pro-inflammatory cytokines and Leydig cells in basal conditions, there were two forms of fractalkine mRNA, one of 3.7 kb and one of 4.2 kb. The 3.7 kb transcript corresponds to the common transcript observed in other tissues (Bazan et al., 1997; Rossi et al., 1998). In Sertoli cells, IFN
and LPS did not induce the 3.7 kb fractalkine transcript, but weak induction was observed with IL-1
, IL-1ß and IL-6 and strong induction with IFN
and TNF
. These activators have been reported to induce the common 3.7 kb transcript in other cellular models (Schwaeble et al., 1998; Harrison et al., 1999; Garcia et al., 2000; Imaizumi et al., 2000). Interestingly, the fractalkine transcript of 4.2 kb discovered here was weakly induced by IFN
, IL-1
and strongly induced by TNF
and IL-1
. Thus, the pattern of induction of the 4.2 kb transcript is different from that of the common 3.7 kb transcript. Furthermore, the 4.2 kb form was induced later than the 3.7 kb form and required a higher concentration of the inflammatory cytokines. Nevertheless, under conditions of maximal induction, the quantity of 4.2 kb transcript was equivalent to that of the 3.7 kb transcript. Thus, when induced by TNF and IL-1, Sertoli cells expressed a large quantity of fractalkine, strongly suggesting a key role of this chemokine in association with IP-10, GRO, RANTES and MCP-1 in leukocyte attraction during an inflammatory process (Aubry et al., 2000a,b; Le Goffic et al., 2002).
We sequenced the 5' region of the 4.2 kb transcript. This sequence presents no open reading frame and is thus a 5' UTR. No AURE motifs able to modulate the half-life of mRNA and determine the protein abundance (Chen and Shyu, 1995; Ross, 1995) are present in this 5' untranslated part. Thus, the 4.2 kb transcript could be regulated by an alternative unidentified upstream promoter, or by specific modulation of the half-life of this mRNA.
As Leydig cells were the strongest producers of fractalkine, we tested whether the elimination of its production affected fractalkine expression in other testicular cells or the spermatogenic process. In-vivo destruction of Leydig cells by a specific toxic drug (EDS) confirmed the specific expression of fractalkine in this cell type. Previous studies have reported a decrease of testosterone production (Sharpe et al., 1990) and an alteration in cytokine expression (Teerds et al., 1990; Yan et al., 2000) following such treatment. Furthermore, destruction of macrophages by Cl2MDP did not seem to affect Leydig cell expression of fractalkine, within the limits of the sensitivity of the immunohistochemical approach. These observations do not support the hypothesis of an interaction between Leydig cells and macrophages via fractalkine and its receptor. Testing for fractalkine within the testis may elucidate this issue. However, current evidence suggests that the expression of fractalkine in Leydig cells does not influence that in other testicular cells (Sertoli cells, pachytene spermatocytes).
In conclusion, fractalkine is expressed in various cell types of the testis, mainly by the Leydig cells, followed by Sertoli cells, spermatogonia and pachytene spermatocytes. In addition to the described 3.7 kb mRNA for fractalkine, a specific 4.2 kb transcript is also present in the testis. These two fractalkine transcripts are differentially regulated by pro-inflammatory cytokines.
Fractalkine expressed in Leydig cells may be preferentially involved in inflammation in the interstitial space, whereas the fractalkine expressed by germ cells may participate in the progress of germ cells to the lumen of seminiferous tubules. Despite the recent report that mice lacking fractalkine are fertile (Cook et al., 2001), spermatic parameters and testicular histology in these animals have not been described.
| REFERENCES |
|---|
|
|
|---|
Aubry, F., Habasque, C., Satie, A., Jégou, B. and Samson, M. (2000a) Expression and regulation of the CXC-chemokines, GRO/KC and IP-10/mob-1, in the rat seminiferous tubules. Eur. Cytokine Netw., 11, 690698.[ISI][Medline]
Aubry, F., Habasque, C., Satie, A., Jégou, B. and Samson, M. (2000b) Expression of the regulation of the CC-chemokines monocyte chemoattractant protein-1 in rat testicular cells in primary culture. Biol. Reprod., 62, 14271435.
Bazan, J.F., Bacon, K.B., Hardiman, G., Wang, W., Soo, K., Rossi, D., Greaves, D.R., Zlotnik, A. and Schall, T.J. (1997) A new class of membrane-bound chemokine with a CX3C motif. Nature, 385, 640644.[CrossRef][Medline]
Bellvé, A., Cavicchia, J.C., Millette, C.F., OBrien, D.A., Bhatnagar, Y.M. and Dym, M. (1977) Spermatogenic cells of the prepubertal mouse. Isolation and morphological characterization. J. Cell Biol., 74, 6885.
Bergh, A., Damber, J.E. and van Rooijen, N. (1993) Liposome-mediated macrophage depletion: an experimental approach to study the role of testicular macrophages in the rat. J. Endocrinol., 136, 407413.[Abstract]
Chapin, R., Phelps, J., Miller, B. and Gray, T. (1987) Alkaline phosphatase histochemistry discriminates peritubular cells in primary rat testicular cell culture. J. Androl., 8, 155161.
Chapman, G.A., Moores, K.E., Gohil, J., Berkhout, T.A., Patel, L., Green, P., Macphee, C.H. and Stewart, B.R. (2000) The role of fractalkine in the recruitment of monocytes to the endothelium. Eur. J. Pharmacol., 392, 189195.[CrossRef][ISI][Medline]
Chen, C.Y. and Shyu, A.B. (1995) AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem. Sci., 20, 465470.[CrossRef][ISI][Medline]
Cook, D.N., Chen, S.C., Sullivan, L.M., Manfra, D.J., Wiekowski, M.T., Prosser, D.M., Vassileva, G. and Lira, S.A. (2001) Generation and analysis of mice lacking the chemokine fractalkine. Mol. Cell. Biol., 21, 31593165.
Dijkstra, C.D., Dopp, E.A., Joling, P. and Kraal, G. (1985) The heterogeneity of mononuclear phagocytes in lymphoid organs: distinct macrophage subpopulations in the rat recognized by monoclonal antibodies ED1, ED2 and ED3. Immunology, 54, 589599.[ISI][Medline]
Dym, M., Jia, M.C., Dirami, G., Price, J.M., Rabin, S.J., Mocchetti, I. and Ravindranath, N. (1995) Expression of c-kit receptor and its autophosphorylation in immature rat type A spermatogonia. Biol. Reprod., 52, 819.[Abstract]
Feinberg, A. and Vogelstein, B. (1983) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem., 132, 613.[CrossRef][ISI][Medline]
Garcia, G.E., Xia, Y., Chen, S., Wang, Y., Ye, R.D., Harrison, J.K., Bacon, K.B., Zerwes, H.G. and Feng, L. (2000) NF-kappaB-dependent fractalkine induction in rat aortic endothelial cells stimulated by IL-1beta, TNF-alpha and LPS. J. Leukoc. Biol., 67, 577584.[Abstract]
Hales, D.B. (1996) Leydig cellmacrophage interactions: an overview. In Payne, A.H., Hardy, M.P. and Russell, L.D. (eds), The Leydig Cells. Cache River Press, Vienna, IL, pp. 451466.
Harrison, J.K., Jiang, Y., Chen, S., Xia, Y., Maciejewski, D., McNamara, R.K., Streit, W.J., Salafranca, M.N., Adhikari, S., Thompson, D.A. et al. (1998) Role for neuronally derived fractalkine in mediating interactions between neurons and CX3CR1-expressing microglia. Proc. Natl Acad. Sci. USA, 95, 1089610901.
Harrison, J.K., Jiang, Y., Wees, E.A., Salafranca, M.N., Liang, H.X., Feng, L. and Belardinelli, L. (1999) Inflammatory agents regulate in vivo expression of fractalkine in endothelial cells of the rat heart. J. Leukoc. Biol., 66, 937944.[Abstract]
Hu, J., You, S., Li, W., Wang, D., Nagpal, M.L., Mi, Y., Liang, P. and Lin, T. (1998) Expression and regulation of interferon-gamma-inducible protein 10 gene in rat Leydig cells. Endocrinology, 139, 36373645.
Hutson, J. (1998) Interactions between testicular macrophages and Leydig cells. J. Androl., 19, 394398.
Imaizumi, T., Matsumiya, T., Fujimoto, K., Okamoto, K., Cui, X., Ohtaki, U., Hidemi, Yoshida and Satoh, K. (2000) Interferon-gamma stimulates the expression of CX3CL1/fractalkine in cultured human endothelial cells. Tohoku J. Exp. Med., 192, 127139.[CrossRef][ISI][Medline]
Itoh, M., De-Rooij, D. and Takeuchi, Y. (1995) Mode of inflammatory cell infiltration in testes of mice injected with syngeneic testicular germ cells without adjuvant. J. Anat., 187, 671679.
Jégou, B. (1993) The Sertoligerm cell communication network in mammals. Int. Rev. Cytol., 147, 2596.[ISI][Medline]
Jégou, B. and Sharpe, R.M. (1993) Paracrine mechanisms in testicular control. In Kretser, D. (ed.), The Molecular Biology of the Male Reproductive System. Academic Press, New York, pp. 271310.
Klinefelter, G.R., Hall, P.F. and Ewing, L.L. (1987) Effect of luteinizing hormone deprivation in situ on steroidogenesis of rat Leydig cells purified by a multistep procedure. Biol. Reprod., 36, 769783.[Abstract]
Le Goffic, R., Mouchel, T., Aubry, F., Patard, J., Ruffault, A., Jégou, B. and Samson, M. (2002) Production of the chemokines MCP-1, RANTES, GRO and IP-10 is induced by the Sendai virus in human and rat testicular cells. Endocrinology, 143, 14341440.
Maciejewski-Lenoir, D., Chen, S., Feng, L., Maki, R. and Bacon, K.B. (1999) Characterization of fractalkine in rat brain cells: migratory and activation signals for CX3CR-1-expressing microglia. J. Immunol., 163, 16281635.
Morris, I.D., Phillips, D.M. and Bardin, C.W. (1986) Ethylene dimethanesulfonate destroys Leydig cells in the rat testis. Endocrinology, 118, 709719.[Abstract]
Muehlhoefer, A., Saubermann, L.J., Gu, X., Luedtke-Heckenkamp, K., Xavier, R., Blumberg, R.S., Podolsky, D.K., MacDermott, R.P. and Reinecker, H.C. (2000) Fractalkine is an epithelial and endothelial cell-derived chemoattractant for intraepithelial lymphocytes in the small intestinal mucosa. J. Immunol., 164, 33683376.
Pan, Y., Lloyd, C., Zhou, H., Dolich, S., Deeds, J., Gonzalo, J.A., Vath, J., Gosselin, M., Ma, J., Dussault, B. et al. (1997) Neurotactin, a membrane-anchored chemokine upregulated in brain inflammation. Nature, 387, 611617.[CrossRef][Medline]
Pineau, C., Le Magueresse, B., Courtens, J. and Jégou, B. (1991) Study in vitro of the phagocytic function of Sertoli cell functions. Cell Tissue Res., 264, 589598.[CrossRef][ISI][Medline]
Pineau, C., Syed, V., Bardin, C., Jégou, B. and Cheng, C. (1993) Germ cell conditioned medium contains multiple factors that modulate the secretion of testins, clusterins and transferrin by Sertoli cells. J. Androl., 14, 8798.
Ross, J. (1995) mRNA stability in mammalian cells. Microbiol. Rev., 59, 423450.
Rossi, D.L., Hardiman, G., Copeland, N.G., Gilbert, D.J., Jenkins, N., Zlotnik, A. and Bazan, J.F. (1998) Cloning and characterization of a new type of mouse chemokine. Genomics, 47, 163170.[CrossRef][ISI][Medline]
Sambrook, J., Fritsch, E. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, New York.
Schall, T. (1997) Fractalkinea strange attractor in the chemokine landscape. Immunol. Today, 18, 147.
Schwaeble, W.J., Stover, C.M., Schall, T.J., Dairaghi, D.J., Trinder, P.K., Linington, C., Iglesias, A., Schubart, A., Lynch, N.J., Weihe, E. et al. (1998) Neuronal expression of fractalkine in the presence and absence of inflammation. FEBS Lett., 439, 203207.[CrossRef][ISI][Medline]
Sharpe, R.M., Maddocks, S. and Kerr, J.B. (1990) Cellcell interactions in the control of spermatogenesis as studied using Leydig cell destruction and testosterone replacement. Am. J. Anat., 188, 320.[CrossRef][ISI][Medline]
Sharpe, R.M., McKinnel, C., Mclaren, T., Millar, M., West, A.P., Maguire, S., Gaughan, J., Syed, V., Jégou, B., Kerr, J.B. et al. (1995) Interactions between androgens, Sertoli cells and germ cells in the control of spermatogenesis. In Verhoeven, G. and Uf, H. (eds), Molecular and Cellular Endocrinology of the Testis. Springer Verlag, pp. 115142.
Skinner, M. and Fritz, I. (1985) Testicular peritubular cells secrete a protein under androgen control that modulates Sertoli cell function. Proc. Natl Acad. Sci. USA, 82, 114118.
Steinberger, E., Steinberger, A. and Vilar, O. (1966) Cytochemical study of delta-5-3-beta-hydroxysteroid dehydrogenase in testicular cells grown in vitro. Endocrinology, 79, 406410.[ISI][Medline]
Teerds, K.J., Rommerts, F.F. and Dorrington, J.H. (1990) Immunohistochemical detection of transforming growth factor-alpha in Leydig cells during the development of the rat testis. Mol. Cell. Endocrinol., 69, R16.[CrossRef][ISI][Medline]
Toebosch, A., Robertson, D., Klaij, I., de Jong, F. and Grootegoed, J. (1989) Effects of FSH and testosterone on highly purified rat Sertoli cells: inhibin alpha subunit mRNA expression and inhibin secretion are enhanced by FSH but not by testosterone. J. Endocrinol., 122, 757762.[Abstract]
Towbin, H., Staehelin, T. and Gordon, J. (1992) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Biotechnology, 24, 145149.[Medline]
Van Rooijen, N. (1989) The liposome-mediated macrophage suicide technique. J. Immunol. Methods, 124, 16.[CrossRef][ISI][Medline]
Veijola, M. and Rajaniemi, H. (1989) Interaction of hCG with testicular interstitial fluid produces a leucotactic factor. Int. J. Androl., 12, 307317.[ISI][Medline]
Walker, W.H., Delfino, F.J. and Habener, J.F. (1999) RNA processing and the control of spermatogenesis. Front. Horm. Res., 25, 3458.[Medline]
Yan, W., Kero, J., Huhtaniemi, I. and Toppari, J. (2000) Stem cell factor functions as a survival factor for mature Leydig cells and a growth factor for precursor Leydig cells after ethylene dimethane sulfonate treatment: implication of a role of the stem cell factor/c-Kit system in Leydig cell development. Dev. Biol., 227, 169182.[CrossRef][ISI][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
W. Xia, D. D Mruk, W. M Lee, and C Y. Cheng Unraveling the molecular targets pertinent to junction restructuring events during spermatogenesis using the Adjudin-induced germ cell depletion model J. Endocrinol., March 1, 2007; 192(3): 563 - 583. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

T = testicular macrophages; PC = peritubular cells; SC = Sertoli cells; SPG = spermatogonia; ES = early spermatids; PS = pachytene spermatocytes. The results shown are representative of two separate experiments.




