Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Jovelin, F.
Right arrow Articles by Lucotte, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jovelin, F.
Right arrow Articles by Lucotte, G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 9, No. 9, 509-516, September 2003
© 2003 European Society of Human Reproduction and Embryology


Article

Molecular basis of the TaqI p49a,f polymorphism in the DYS1 locus containing DAZ genes

Submitted on February 6, 2003; accepted on May 19, 2003

F. Jovelin, S. Berthaud and G. Lucotte1

Centre de Neurogénétique Moléculaire, 44 rue Monge, 75005 Paris, France

1 To whom correspondence should be addressed. e-mail: Lucotte{at}hotmail.com


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
The previously described TaqI p49a,f polymorphism at the DYS1 locus in the non-recombinant part of the Y chromosome is widely exploited to investigate many facets of human population genetics. It has been shown that the DYS1 locus corresponds to the four DAZ genes in the AZF-c region of the Y chromosome. As the DNA sequence of the DAZ genes is known in its entirety, it is now possible to establish correspondences between the main Southern polymorphic TaqI bands (A, C, D, F and I) at the DYS1 locus and TaqI fragments deduced from the sequence, by way of comparing band sizes and sequence homologies between hybridized fragments. Transitions between polymorphic forms for each variable TaqI fragment can be explained regarding the restriction maps, by postulating a parsimonious number of TaqI site losses during human evolution. Most of the codon changes caused by TaqI site losses located in the exons of the four DAZ genes have potentially high selective values.

Key words: AZF-c DAZ genes/DYS1/mutations by TaqI site loss/p49a,f TaqI polymorphism/selection


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
The human Y chromosome-specific p49a,f/TaqI polymorphism, described >15 years ago (Lucotte and Ngo, 1985), was the first described polymorphism which emerged from conventional Southern restriction fragment length polymorphisms (RFLP) searches on the Y chromosome (Ngo and Lucotte, 1986). The p49a and p49f probes, 6 kb distant from each other, were subclones of cosmid 49 (Bishop et al., 1983); they hybridize to the DYS1 locus at Yq11.2 (Quack et al., 1988), in the non-recombinant part of the Y chromosome. After TaqI digestion, probes p49f and p49a detect, in combination, 18 restriction fragments (bands) of different sizes named A to R (by size order, with band A being the largest and band R being the smallest). All these bands are male specific, but bands K and L are autosomal and correspond to homologous DYS1 sequences located on chromosome 3 (Lucotte et al., 1990a). At least five bands (A, C, D, F and I) are polymorphic between individuals (Lucotte and Ngo, 1985): band A has four possible sizes (A4 = 19.6 kb, A3 = 17.3 kb, A2 = 14.8 kb, A1 = 11.1 kb) or can be absent (A0); band D has two possible sizes (D1 = 7.2 kb, or D2 = 6.9 kb) or can be absent (D0); bands C, F and I can be present (C1 = 7.9 kb, F1 = 5.1 kb, I1 = 3.1 kb) or absent (C0, F0 and I0).

TaqI haplotypes (deduced by combinations of the various polymorphic TaqI fragments) detected by p49a,f probes (Ngo et al., 1986) were the most used marker for population studies (Breuil et al., 1987; Lucotte et al., 1989, 1990b, 1991a, 1993, 1994; Torroni et al., 1990; Lucotte and David, 1992; Persichetti et al., 1992; Spurdle and Jenkins, 1992; Santachiara-Benerecetti et al., 1993; Jobling, 1994). These conventional Y-specific RFLP were the most popular marker used in various populations, because of their ability to detect >100 different distinct haplotypes (for a compilation on the subject until the end of 1995, see Poloni et al., 1997). We (Lucotte and Hazout, 1996; Lucotte et al., 1996, 2000, 2001, 2002; Lucotte and Loirat, 1999; Lucotte and Smets, 1999; Lucotte and Gérard, 2002) and others (Huoponen et al., 1997; Lell et al., 1997; Passarino et al., 1998, 2001; Semino et al., 2000) have continued to utilize TaqI 49a,f haplotypes to study various human populations.

We initially sequenced the p49a probe (Lucotte et al., 1991b). This sequence has been shown to correspond to the DAZ (Deleted in Azoospermia) locus, located on the Y-chromosome AZF (A Zoospermia Factor)-c region (Reijo et al., 1995). Nucleotide sequence analysis of DAZ cDNA clones revealed a single long open reading frame (366 amino acids). Features of the DAZ coding region included nine tandem repeats of a 72 nt unit exhibiting remarkable nucleotide identity to one unit of p49a (Lucotte et al., 1991b; Reijo et al., 1995).

Identity between the DYS1 locus and the DAZ cDNA was established further (Reijo et al., 1995), and TaqI K and L bands were shown to correspond to gene DAZH (DAZ homologue), located on chromosome 3 (Saxena et al., 1996). In fact the DYS1 locus corresponds to a cluster of DAZ genes (Saxena et al., 1996), located on the Y chromosome. There are four full-length DAZ genes on the Y chromosome (Saxena et al., 2000) grouped in two clusters, each comprising an inverted pair of DAZ genes (in the following order: 3' -> 5'DAZ1: 5' -> 3'DAZ2; 3' -> 5'DAZ3: 5' -> 3'DAZ4).

The AZF-c region containing the four DAZ genes is now completely sequenced (Kuroda-Kawaguchi et al., 2001). Here we examine by an ‘in-silico’ analysis the correspondence between sequenced TaqI fragments in DAZ1, DAZ2, DAZ3 and DAZ4 genes and TaqI fragments detected by p49a,f probes (Lucotte and Ngo, 1985), to elucidate the molecular basis of the TaqI p49a,f polymorphisms. The large amount of data already accumulated using the main TaqI p49a,f polymorphisms could be enhanced by a molecular understanding of the basis of this extraordinary variation at the DYS1 locus of the Y chromosome.


    Materials and methods
 Top
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Sizes of the constant TaqI bands
B = 10.1 kb; E = 5.9 kb; G = 4.8 kb; H = 4 kb; J = 2.7 kb; M = 2 kb; N = 1.9 kb; 0 = 1.8 kb; P = 1.4 kb; Q = 1.2 kb; R = 0.9 kb (Lucotte and Ngo, 1985).

Differential hybridization between the p49f and p49a probes
In high stringency conditions of hybridization (Ngo et al., 1986) autosomal bands K and L, bands E, J, N, O and Q, as well as dimorphic fragment I, are no longer detected by probe p49a; the larger polymorphic fragments (A and D) show the same allelic variations as with probe p49f.

DAZ consensus repeat, and homology between DAZ exons and introns
The 72 nt unit (Reijo et al., 1995): GCATTTCCTGCTTATCCAAATTCACCATTTCAAAGTCGCCACTGGATATCAGTTCCC(T)TGTATACAATTATCAG corresponds to the homologous sequence (bases in bold type correspond to differences between the two sequences) of the p49a probe (Lucotte et al., 1991b). Homologies between exons and introns in the four DAZ genes were tested by using the FASTA function (optimized, DNA matrix) htup: 6; join: 54; opt: 39; gap-pen: –16/4; width: 16.

Initial sequence of the DAZ3 gene
The first 40 328 bp DNA sequence of the DAZ gene, corresponding to the clone 63C9 (accession number AC000021) was directly sent to us by S.Rozen (Whitehead/MIT Center for Genome Research, Cambridge, MA, USA).

We studied a 4.5 Mb sequence (http://genome.ucsc.edu) which corresponds to BAC of the complete AZF-c region of the Y chromosome (Kuroda-Kawaguchi et al., 2001) in UCSC (Human Genome Project Working Draft). The numbering system is that adopted in the original DNA sequence. TaqI sites were identified using the DNASTAR program. All clones originated from the RPCI-11 BAC library: AC006328 (RP11-102O5); AC006386 (RP11-566H16); AC006990 (RP11-226N11); AC007273 (RP11-79J10); AC007322 (RP11-553C13); AC007965 (RP11-245K4); AC008272 (RP11-141N4); AC010088 (RP11-289L7); AC010682 (RP11-251M8); AC013465 (RP11-424J12); AC016707 (RP11-221K4); AC016911 (RP11-473E1); AC023274 (RP11-307L15); AC024236 (RP11-400I17); AC025735 (RP11-214M24); AC068601 (RP11-1067I16); AC006338 (RP11-539D10); AC06982 (RP11-26D12); AC006991 (RP11-270H4); AC007315 (RP11-189B16); AC007359 (RP11-66M18); AC008061 (RP11-59C12); AC009947 (RP11-39P20); AC010089 (RP11-290O3); AC010898 (RP11-535B9); AC016694 (RP11-123G1); AC016728 (RP11-363G6); AC017005 (RP11-100J21); AC023342 (RP11-95B23); AC025227 (RP11-109G18); AC053490 (RP11-140H23); AC073649 (RP11-823D8); AC006366 (RP11-86G22); AC006983 (RP11-70G12); AC007039 (RP11-263A15); AC007320 (RP11-477B5); AC007562 (RP11-497C14); AC008175 (RP11-427G18); AC010080 (RP11-5C5); AC010153 (RP11-535I13); AC012005 (RP11-533E23); AC016698 (RP11-160O2); AC016752 (RP11-506M9); AC017045 (RP11-322J1); AC024067 (RP11-487K20); AC025246 (RP11-589P14); AC068543 (RP11-354H19); AC073893 (RP11-978G18).


    Results
 Top
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Homology of DNA sequences in the DAZ genes
According to Saxena et al. (1996), taking DAZ3 as the DAZ reference gene, the sequence of the p49a probe corresponds to exon 7d and part of intron 7, and the sequence of the p49f probe corresponds to: part of intron 3, exons 4–6 and the corresponding introns, exons 7a and 7b, and part of its intron. More recently (Fernandes et al., 2002) the p49f probe was resequenced (accession number AF14183); taking DAZ1 as the DAZ reference gene, the sequence of p49f corresponds to the EcoRI fragment in the DAZ1 gene starting in intron 1 and ending in intron 7b. The DAZ repeat unit (Reijo et al., 1995) is contained in exons 7a to 7g in the DAZ3 gene. We have compared the AF14183 sequence with the corresponding exon sequences of the four DAZ genes; in our experiment the better match is with exons 4–7 of the DAZ2 gene.

Figures 1 and 2 indicate position and nomenclature of TaqI sites and exons in the four DAZ genes. Exons containing the DAZ repeat unit, in the new simplified nomenclature of the DAZ genes we adopted, are: exons 7–16 for the DAZ3 gene, exons 7–25 in the DAZ2 gene, exons 12–26 in the DAZ4 gene, exons 17–25 in the DAZ1 gene. Intron 7 in the DAZ3 gene is homologous to intron 17 in the DAZ1 gene, to intron 12 in the DAZ4 gene, and to introns 19–22 in the DAZ2 gene. Introns 2–6 in the DAZ3 gene are homologous to introns 2–6 in the DAZ2 gene, to introns 2–6 and 7–11 in the DAZ4 gene, and to introns 2–6, 7–11 and 12–16 in the DAZ1 gene.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 1. Genomic organization of the two DAZ1 and DAZ2 genes in the first cluster and TaqI restriction maps. Arrows indicate the direction of transcription in the DAZ genes. Bellow the base numbers nomenclature, DAZ exons (numbers 1–28) are numbered and their positions are indicated. In the DAZ2 gene the D1 polymorphic band corresponds to the TaqI fragment containing exons numbered 13–15, and the I1 dimorphic band corresponds to the TaqI fragment containing intron 6.

 


View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Genomic organization of the two DAZ3 (19 exons) and DAZ4 (29 exons) genes in the second cluster and TaqI restriction maps. In the DAZ3 gene the A4 polymorphic band corresponds to the TaqI fragment containing exons numbered 9–15, and in the DAZ4 gene the A2 polymorphic band corresponds to the TaqI fragment containing exons numbered 16–20.

 
Correspondence between TaqI fragments and hybridized bands
Tables I, II, III and IV summarize positions and sizes of TaqI fragments in the four DAZ genes. The DYS1 locus corresponds to the four DAZ gene exon–intron structure. We have taken the available DAZ gene sequence in the DYS1 locus in which the p49a,f hybridizing sequences lie, and have performed an in-silico TaqI digest to correlate the predicted TaqI fragment sizes with those published in the literature.


View this table:
[in this window]
[in a new window]
 
Table I. Positions of TaqI sites, numbers of the corresponding fragments, positions of exons (numbers 1–28) in fragments, and sizes of TaqI fragments in the DAZ1 gene
 

View this table:
[in this window]
[in a new window]
 
Table II. Positions of TaqI sites, numbers of the corresponding fragments, positions of exons (numbers 1–28) in fragments, and sizes of TaqI fragments in the DAZ2 gene
 

View this table:
[in this window]
[in a new window]
 
Table III. Positions of TaqI sites, numbers of the corresponding fragments, positions of exons (numbers 1–22) in fragments, and sizes of TaqI fragments in the DAZ3 gene
 

View this table:
[in this window]
[in a new window]
 
Table IV. Positions of TaqI sites, numbers of the corresponding fragments, positions of exons (numbers 1–36) in fragments, and sizes of TaqI fragments in the DAZ4 gene
 
Two TaqI restriction fragments correspond to polymorphic forms of the A band: the 19 612 bp fragment number 11 containing exons 9–15 in the DAZ3 gene (the polymorphic A4 band), and the 14 853 bp fragment number 17 containing exons 16–20 in the DAZ4 gene (the polymorphic A2 band). It must be noted that the correspondences between the sizes predicted from the sequence and those previously published from Southern hybridizations are not very precise (especially for the large TaqI fragments corresponding to the A band allelic series).

Two restriction fragments correspond to the B band: the 10 094 bp number 14 containing exons 21–23 in the DAZ1 gene, and the 10 100 bp number 14 containing exons 16–18 in the DAZ2 gene. No fragment corresponds to the dimorphic C1 band. The 7152 bp fragment number 13 containing exons 13–15 in the DAZ2 gene corresponds to the polymorphic D1 band.

Three fragments correspond to the E band: two 5857 bp fragments (number 26 in the DAZ1 gene and number 9 in the DAZ4 gene) containing intron 6, and the 5854 bp fragment number 22 in the DAZ1 gene containing intron 11. No fragment corresponds to the dimorphic F1 band. Four fragments correspond to the G band: the number 15 fragment (4782 bp) containing exons 19 and 20 in the DAZ1 gene, the number 11 fragment (4781 bp) containing exons 9 and 10 and the number 12 fragment (4780 bp) containing exons 11 and 12 (both in the DAZ2 gene), and the number 16 fragment (4783 bp) containing exons 14 and 15 in the DAZ4 gene. The 4020 bp fragment number 8 containing exon 25 in the DAZ1 gene corresponds to the H band.

The 3112 bp number 9 containing part of intron 6 in the DAZ2 gene corresponds to the polymorphic I1 band. At least three fragments correspond to the J band: the number 24 fragment (2733 bp) containing part of intron 6 and the number 20 fragment (2728 bp) containing part of intron 11 in the DAZ1 gene, and the number 11 fragment (2733 bp also) containing part of intron 6 in the DAZ4 gene.

Four fragments correspond to the M band: two 2076 bp fragments (number 16 containing exon 18 in the DAZ1 gene, and number 10 containing exon 8 in the DAZ2 gene), and two 2075 bp fragments (number 12 containing exon 8 in the DAZ3 gene and number 15 containing exon 13 in the DAZ4 gene). At least seven 1992 bp fragments correspond to band N: fragment number 27 (containing introns 4–6), fragment number 23 (containing introns 9–11), fragment number 19 (containing introns 14–16) in the DAZ1 gene; fragment number 8 (containing introns 4–6) in the DAZ2 gene; fragment number 15 (containing introns 4–6) in the DAZ3 gene; fragment number 8 (containing introns 4–6) and fragment number 12 (containing introns 9–11) in the DAZ4 gene. Three fragments correspond to band O: two 1 876 bp fragments (number 14 containing part of intron 6 in the DAZ3 gene and number 13 containing part of intron 11 in the DAZ4 gene), and one 1877 bp fragment (number 18 containing part of intron 16 in the DAZ1 gene).

At least five fragments in the DAZ2 gene correspond to the P band: four 1418 bp fragments (number 20 containing intron 19, number 24 containing intron 21, number 26 containing intron 22) and one 1419 bp fragment (number 22 containing intron 20). Three fragments correspond to the Q band: one 1235 bp fragment (number 14 containing intron 12 in the DAZ4 gene), one 1236 bp fragment (number 13 containing a part of intron 7 in the DAZ3 gene), and one 1237 bp fragment (number 17 containing a part of intron 17 in the DAZ1 gene). At least six 966 bp fragments correspond to the R band: the five fragments number 19 containing exon 19, number 21 containing exon 20, number 23 containing exon 21, number 25 containing exon 22, number 27 containing exon 23 (in the DAZ2 gene), and the fragment number 9 containing exon 24 in the DAZ1 gene.

Concerning polymorphic TaqI fragments, the male DNA donor for the original RP11 library had the following haplotype: A4 = 19.6 kb/A2 = 14.8 kb; C0; D1 = 7.1 kb; F0; I1 = 3.1 kb. He represents an uncommon haplotype. Individuals with two A bands are known (Torroni et al., 1990) but are rare. At least two individuals are therefore likely to be at the origin of the library, with the following haplotypes: A4, C0, D1, F0, I1, and A2, C0, D1, F0, I1.

Explanation concerning the transitions between the different polymorphic forms
Comparisons between TaqI restriction maps of the four DAZ genes allow us to understand how polymorphic bands could evolve parsimoniously during evolutionary time, according to the mechanism of TaqI site loss already described (Hazout and Lucotte, 1986; Ngo et al., 1986). We have therefore tried to guess what new fragment sizes could be produced by the loss of existing TaqI sites to give other previously described fragments. For example, the loss of the TaqI site 3036716 located between fragment number 16 (a G band) and fragment number 17 (the polymorphic A2 band) in the DAZ4 gene gives a fragment of 4783 + 14 853 bp = 19.6 kb, corresponding to the polymorphic A4 band. In a similar fashion the loss of the TaqI site 1330734 between fragment number 14 (a B band) and fragment number 15 (a G band) in the DAZ1 gene gives a fragment of 10 094 + 4782 bp = 14.8 kb, corresponding to the polymorphic A2 band.

The loss of the TaqI site 1423412 between fragment number 13 (the dimorphic D1 band) and fragment number 14 (a B band) in the DAZ2 gene gives a fragment of 7152 + 10 100 bp = 17.3 kb, corresponding to the polymorphic A3 band (this transformation also allows us to explain the form D0). The loss of the TaqI site 1433512 between fragments number 14 and number 15 in the DAZ2 gene, or the loss of the TaqI site 1320640 between fragment numbers 13 and number 14 in the DAZ1 gene gives, respectively, a fragment of 10 100 + 1033 bp and a fragment of 1033 + 10 094 bp = 11.1 kb, corresponding to the polymorphic A1 band.

The polymorphic D2 band can be explained by the loss of the TaqI site 1406699 between the fragment number 10 (a M band) and the fragment number 11 (a G band) in the DAZ2 gene, or by the loss of the TaqI site 1335516 between the fragment number 15 and the fragment number 16 in the DAZ1 gene, or again by the loss of the TaqI site 3031933 between fragment number 15 and fragment number 16 in the DAZ4 gene (giving respectively fragments of 2076 + 4781 bp, 4782 + 2076 bp and 2075 + 4783 bp = 6.9 kb).

The loss of the TaqI site 1351546 between fragment number 22 (a G band) and fragment number 23 (a N band), or the TaqI 1362394 site between fragments number 26 and 27 in the DAZ1 gene, or again the loss of the TaqI site 3015898 between fragment numbers 8 and 9 in the DAZ4 gene, give respectively fragments of 5884 + 1992 bp, 5857 + 1992 bp and 1992 + 5857 bp = 7.9 kb, corresponding to the dimorphic C1 band.

The loss of the TaqI site 1401511 between fragment number 8 (a N band) and fragment number 9 (the I1 band) gives a fragment of 1992 + 3112 bp = 5.1 kb, corresponding to the dimorphic F1 band.

The present study explains by TaqI site loss the most common polymorphic bands and haplotypes, at the DYS1 locus found in human populations. Rarer haplotypes, found essentially in some African populations (for example, see Torroni et al., 1990) and in some very peculiar cases concerning male sterility (the first example was in Guérin et al., 1988), and arising from duplication/deletion of the DAZ repeat units are not taken into consideration in the present work.


    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
We have established the molecular basis of the TaqI p49a,f polymorphism at the DYS1 locus. These polymorphisms corresponding to genes located in the non-recombinant part of the human Y chromosome were discovered >15 years ago (Lucotte and Ngo, 1985) and are currently used in human population genetics studies. The basis of the findings resulted from in-silico comparisons between the lengths of the Southern TaqI polymorphic bands with those of the TaqI fragments based on the recently published (Kuroda-Kawaguchi et al., 2001; Fernandes et al., 2002) DNA sequence in the DYS1 locus containing the four DAZ genes region (Saxena et al., 2000). Polymorphism at the main five A, C, D, F and I hybridizing bands and phylogeny of the deduced haplotypes could be explained by single parsimonious transitions between forms resulting from TaqI site loss during human evolution (Ngo et al., 1986), as predicted in Hazout and Lucotte (1986).

An important matter is to know if polymorphic TaqI losses during evolution were introducing amino acid changes at the DAZ product level. In mammalian cells in general, DNA methylation occurs mostly at the C residue of CpG dinucleotides, and a methylated C residue is transformed to a T through deamination which creates a C -> T transitional mutation; if the C -> T transition occurs on the antisense strand, it is reflected as a G -> A transition on the sense strand. Because methylation occurs at a considerably higher rate in sperm DNA than in oocyte DNA (Monk, 1995), it increases the frequency of the paternal origin of the mutation.

Yq11.3 located DAZ genes, and the human autosomal DAZL1 gene (Yen et al., 1996) located 3p24, have a functional role in fertility: they are expressed exclusively in germ cells (Cooke et al., 1996; Ruggiu et al., 1997; Gromoll et al., 1999) and in humans DAZ expression is highest in spermatogonia (Menke et al., 1997; Vogel et al., 2002); Y-encoded human DAZ can complement the sterile phenotype of DAZL1 null mice yielding a partial recovery of spermatogenesis (Slee et al., 1999), which suggests the same or similar target mRNA for DAZ and DAZL1 during spermatogenesis. Although the specific functions of DAZ and DAZL1 are unknown, the presence of RNA recognition motifs suggests that these genes could be involved in controlling the cell cycle switch from mitotic to meiotic cell divisions.

A total of 15 TaqI sites (TCGA) are contained in the exons of the four DAZ genes (Figures 1 and 2): five in the DAZ1 gene (in exons 1, 16, 21, 26 and 28), three in the DAZ2 gene (in exons 1, 3 and 28), three in the DAZ3 gene (in exons 1, 17 and 19) and four in the DAZ4 gene (in exons 1, 3, 8 and 29).

In Table V are summarized the results of simulations of in-silico C -> T mutagenesis in the corresponding coding sequences of these 15 TaqI sites. Only two sorts of codon changes occur: the first is the ATC -> ATT which occurs three times only (in the codons corresponding to TaqI sites in exon 1 of the DAZ1 gene, in exon 28 of the DAZ2 gene and in exon 1 of the DAZ3 gene); the second is the CGA -> TGA change, which occurs in all the 12 other TaqI sites. The first sort of mutation is neutral at the protein level for the DAZ products, because the amino acid leucine is conserved by the change; but the second sort of mutation is marked in the 12 other cases (80%), where the amino acid arginine is changed in a stop signal.


View this table:
[in this window]
[in a new window]
 
Table V. Simulation of C -> T transitions in exon TaqI sites in the four DAZ genes
 
We do not know if all the four DAZ genes are expressed in vivo, but it seems remarkable that the great majority of codon changes caused by the driven loss of TaqI sites in human evolution have a high potential counter-selective value.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Bishop, C., Guellaen, G., Gelwerth, D., Voss, R., Fellous, M. and Weissenbach, J. (1983) Single copy DNA sequences specific for the human Y chromosome. Nature, 303, 831–832.[CrossRef][Medline]

Breuil, S., Hallé, L., Ruffié, J. and Lucotte, G. (1987) Polymorphisme d’une sonde-Y-spécifique nommée p49 chez les Papous Baruyas de Nouvelle-Guinée. Ann. Génét., 30, 209–212 (in French).[ISI][Medline]

Cooke, H.J., Lee, M., Kerr, S. and Ruggiu, M. (1996) A murine homologue of the human DAZ gene is autosomal and expressed only in male and female gonads. Hum. Mol. Genet., 5, 513–516.[Abstract/Free Full Text]

Fernandes, S., Huellen, K., Goncalves, J., Dukal, H., Zeisler, J., Rajpert De Meyts, E., Skakkeback, N.E., Habermann, B., Krauze, W., Souza, M. et al. (2002) High frequency of DAZ1/DA2 gene deletions in patients with severe oligozoospermia. Mol. Hum. Reprod., 8, 286–298.[Abstract/Free Full Text]

Gromoll, J., Weinbauer, G.F., Skaletsky, H., Schlatt, S., Rocchietti-March, M., Page, D.C. and Nieschlag, E. (1999) The old world monkey DAZ gene yields insights into the evolution of the DAZ gene cluster on the human Y chromosome. Hum. Mol. Genet., 8, 2017–2024.[Abstract/Free Full Text]

Guérin, P., Rouger, P. and Lucotte, G. (1988) A new TaqI B0 variant detected with p49 probe on the human Y chromosome. Nucleic Acids Res., 15, 7759.

Hazout, S. and Lucotte, G. (1986) Vers une généalogie du chromosome Y. Ann. Génét., 29, 246–252 (in French).[ISI][Medline]

Huoponen, K., Torroni, A., Wickman, P.R., Sellitto, D., Gurley, D.S., Scozzani, R. and Wallace, D.C. (1997) Mitochondrial DNA and Y chromosome specific polymorphisms in the Seminole tribe of Florida. Eur. J. Hum. Genet., 5, 25–34.[ISI][Medline]

Jobling, M. (1994) A survey of long-range DNA polymorphisms on the human Y chromosome. Hum. Mol. Genet., 3, 107–114.[Abstract/Free Full Text]

Kuroda-Kawaguchi, T., Skaletsky, H., Brown, L.G., Minx, P.J., Cordum, H.S., Waterson, R.H., Wilson, R.K., Silber, S. Oates, R., Rozen, S. et al. (2001) The AZF-c region of the Y chromosome features massive palindromes and uniform recurrent deletions in fertile men. Nat. Genet., 29, 279–286.[CrossRef][ISI][Medline]

Lell, J.T., Brown, M.D., Schurr, T.G., Sukernik, R.I., Starikovskaya, Y.B., Torroni, A., Moore, L.G., Troup, G.M. and Wallace, D.C. (1997) Y chromosome polymorphisms in Native American and Siberian populations: identification of Native American Y chromosome haplotypes. Hum. Genet., 100, 536–543.[CrossRef][ISI][Medline]

Lucotte, G. and David, F. (1992) Y-chromosome specific haplotypes of Jews detected by probes 49f and 49a. Hum. Biol., 64, 757–761.[ISI][Medline]

Lucotte, G. and Gérard, N. (2002) Haplotypes of the Y chromosome in some populations of West Africa. Int. J. Anthropol., 17, 1–5.

Lucotte, G. and Hazout, S. (1996) Y-chromosome DNA haplotypes in Basques. J. Mol. Evol., 42, 472–475.[ISI][Medline]

Lucotte, G. and Loirat, F. (1999) Y-chromosome haplotype XV in Europe. Hum. Biol., 71, 431–437.[ISI][Medline]

Lucotte, G. and Ngo, K.Y. (1985) P49f, a highly polymorphic probe that detects RFLPs on the human Y chromosome. Nucleic Acids Res., 13, 8285.[Free Full Text]

Lucotte, G. and Smets, P. (1999) Origin of Falasha Jews studied by haplotypes of the Y chromosome. Hum. Biol., 71, 989–993.[ISI][Medline]

Lucotte, G., Guérin, P., Hallé, L., Loirat, F. and Hazout, S. (1989) Y chromosome DNA polymorphism in two Africans populations. Am. J. Hum. Genet., 45, 16–20.[ISI][Medline]

Lucotte, G., Barriel, V., Guérin, P., Abbas, N. and Ruffié, J. (1990a) Rétro-transposition de la séquence humaine homologue à la p49f sur le chromosome Y au cours de l’évolution des singes Anthropoïdes. Biochem. Syst. Ecol., 18, 1999–2004 (in French).

Lucotte, G., Sriniva, K.R., Loirat, F., Hazout, S. and Ruffié, J. (1990b) The p49/TaqI Y-specific polymorphisms in three groups of Indians. Gene Geogr., 4, 21–28.[Medline]

Lucotte, G., Hazout, S. and Summers, K.M. (1991a) The p49/TaqI Y-specific DNA haplotypes in Australian aborigines. Gene Geogr., 5, 131–136.[Medline]

Lucotte, G., David, F. and Mariotti, M. (1991b) Nucleotide sequence of p49a, a genomic Y-specific probe with potential utilization in sex determination. Mol. Cell. Probes, 5, 359–363.[ISI][Medline]

Lucotte, G., Smets, P. and Ruffié, J. (1993) Y-chromosome specific haplotype diversity in Ashkenazi and Sephardic Jews. Hum. Biol., 65, 835–840.[ISI][Medline]

Lucotte, G., Gérard, N., Krishnamoorthy, R., David, F., Aouizérate, A. and Galzot, P. (1994) Reduced variability in Y-chromosome specific haplotypes for some Central African populations. Hum. Biol., 66, 519–526.[ISI][Medline]

Lucotte, G., David, F. and Berriche, S. (1996) Haplotype VIII of the Y chromosome is the ancestral haplotype in Jews. Hum. Biol., 68, 467–471.[ISI][Medline]

Lucotte, G., Aouizérate, A. and Berriche, S. (2000) Y-chromosome DNA haplotypes in North-African populations. Hum. Biol., 72, 473–480.[ISI][Medline]

Lucotte, G., Gérard, N. and Mercier, G. (2001) North-African genes in Iberia studied by Y-chromosome DNA haplotype V. Hum. Immunol., 62, 885–888.[CrossRef][ISI][Medline]

Lucotte, G., Pinna, A. and Mercier, G. (2002) Haplotypes du chromosome Y en Corse. C. R. Biologies, 325, 191–196 (in French).

Menke, D.B., Mutter, G.L. and Page, D.C. (1997) Expression of DAZ, an azoospermia factor candidate in human spermatogonia. Am. J. Hum. Genet., 60, 237–241.[ISI][Medline]

Monk, M. (1995) Epigenic programming of differential gene expression in development and evolution. Dev. Genet., 17, 188–197.[CrossRef][ISI][Medline]

Ngo, K.Y. and Lucotte, G. (1986) Statégies de recherche des polymorphismes de restriction des séquences du chromosome Y. Ann. Génét., 29, 88–92 (in French).[ISI][Medline]

Ngo, K.Y., Vergnaud, G., Johnsson, C., Lucotte, G. and Weissenbach, J. (1986) A DNA probe detecting multiple haplotypes on the human Y chromosome. Am. J. Hum. Genet., 38, 407–418.[ISI][Medline]

Passarino, G., Semino, O., Quintana-Murci, L., Excoffier, L., Hammer, M. and Santachiara-Benerecetti, A.S. (1998) Different genetic components in the Ethiopian population identified by mt-DNA and Y-chromosome polymorphisms. Am. J. Hum. Genet., 62, 420–434.[CrossRef][ISI][Medline]

Passarino, G., Semino, O., Magri, C., Al-Zahery, N., Benuzzi, G., Quintana-Murci, L., Andellnovic, S., Bullc-Jakus, F., Liu, A., Arolan, A. et al. (2001) The 49a,f haplotype 11 is a new marker of Eu19 lineage that traces migrations from northern regions of the black sea. Hum. Immunol., 62, 922–932.[CrossRef][ISI][Medline]

Persichetti, F., Blasi, P., Hammer, M., Malaspina, P., Jodice, C., Terrenato, L. and Novelletto, A. (1992) Disequilibrium of multiple DNA markers on the human Y chromosome. Ann. Hum. Genet., 56, 303–310.[ISI][Medline]

Poloni, E.S., Semino, O., Passarino, G., Santachiara-Benerecetti, A.S., Dupanloup, I., Langaney, A. and Excoffier, L. (1997) Human genetic affinities for Y-chromosome p49a,f/TaqI haplotypes show strong correspondence with linguistic. Am. J. Hum. Genet., 61, 1015–1035.[CrossRef][ISI][Medline]

Quack, B., Guérin, P., Ruffié, J. and Lucotte, G. (1988) Mapping of probe p49f to the proximal part of the human Y chromosome long arm. Cyt. Cell Genet., 47, 232.

Reijo, R., Lee, T.Y., Salo, P., Alagappan, R., Brown, L.G., Rosenberg, M., Rozen, S., Jaffe, T., Strauss, D., Hovatta, O. et al. (1995) Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nat. Genet., 10, 383–393.[CrossRef][ISI][Medline]

Ruggiu, M., Speed, R., Taggart, M., McKay, S.J., Kilanowski, F., Saunders, P., Dorin, J. and Cooke, H.J. (1997) The mouse DAZL1a encodes a cytoplasmic protein essential for gametogenesis. Nature, 389, 73–77.[CrossRef][Medline]

Santachiara-Benerecetti, A.S., Semino, O., Passarino, G., Torroni, A., Brdicka, R., Fellous, M. and Modiano, G. (1993) The common, Near-Eastern origin of Ashkenazi and Sephardi Jews supported by Y-chromosome similarity. Ann. Hum. Genet., 57, 55–64.[ISI][Medline]

Saxena, R., Brown, L., Hawkins, T., Alagappan, R.K., Skaletsky, H., Reeve, M.P., Reijo, R., Rozen, S., Dinulos, M.B., Disteche, C.M. et al. (1996) The DAZ gene cluster on the human Y chromosome arose from an autosomal gene that was transposed repeatedly amplified and pruned. Nat. Genet., 14, 292–299.[CrossRef][ISI][Medline]

Saxena, R., de Vries, J.W.A., Repping, S., Alagappan, R.K., Skaletsky, H., Brown, L., Ma, P., Chen, E., Hoovers, J.M.N. et al. (2000) Four DAZ genes in two clusters found in the AZFc region of the human Y chromosome. Genomics, 67, 256–267.[CrossRef][ISI][Medline]

Semino, O., Passarino, G., Quintana-Murci, L., Liu, A., Beres, J., Czeizel, J. and Santachiara-Benerecetti, A.S. (2000) MtDNA and Y-chromosome polymorphisms in Hungary, inferences on the Paleolithic, Neolithic and Uralic influence on the modern Hungarian gene pool. Eur. J. Hum. Genet., 5, 339–346.[CrossRef]

Slee, R., Grimes, B., Speed, R.M., Taggart, M., Maguire, S.M., Ross, A., McGill, N.I., Saunders, P.T.K. and Cooke, H.J. (1999) A human DAZ transgene confers partial rescue of the mouse Dazl null phenotype. Proc. Natl Acad. Sci. USA, 96, 8040–8045.[Abstract/Free Full Text]

Spurdle, A. and Jenkins, T. (1992) Y chromosome probe p49a detects complex PvuII haplotypes and many new TaqI haplotypes in southern African populations. Am. J. Hum. Genet., 50, 107–125.[ISI][Medline]

Torroni, A., Semino, O., Scozzari, R., Sirugo, G., Spedini, G., Abbas, N., Fellous, M. and Santachiara-Benerecetti, A.S. (1990) Y chromosome DNA polymorphisms in human populations, differences between Caucasoids and Africans detected by 49a and 49f probes. Ann. Hum. Genet., 54, 287–296.[ISI][Medline]

Vogel, T., Speed, R.M., Ross, A. and Cooke, H.J. (2002) Partial rescue of the Dazl knockout mouse by the human DAZL gene. Mol. Hum. Reprod., 8, 797–804.[Abstract/Free Full Text]

Yen, P.H., Chai, N.N. and Salido, E.C. (1996) The human autosomal gene DAZLA: testis specificity and a candidate for male infertility. Hum. Mol. Genet., 12, 2013–2017.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Hum Reprod UpdateHome page
P. H. Vogt
AZF deletions and Y chromosomal haplogroups: history and update based on sequence
Hum. Reprod. Update, July 1, 2005; 11(4): 319 - 336.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Jovelin, F.
Right arrow Articles by Lucotte, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jovelin, F.
Right arrow Articles by Lucotte, G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?