Skip Navigation



Mol. Hum. Reprod. Advance Access published online on January 26, 2007

Molecular Human Reproduction, doi:10.1093/molehr/gal112
This Article
Right arrow Abstract Freely available
Right arrow Advance Access manuscript (PDF) Freely available
Right arrow All Versions of this Article:
13/3/149    most recent
gal112v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Jacobs, L.
Right arrow Articles by Smeets, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jacobs, L.
Right arrow Articles by Smeets, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

mtDNA point mutations are present at various levels of heteroplasmy in human oocytes

Lorraine Jacobs1,2, Mike Gerards1, Patrick Chinnery3, John Dumoulin4, Ireneaus de Coo5, Joep Geraedts1 and Hubert Smeets1,6

1 Department of Genetics and Cell Biology 2 Research institute GROW, University of Maastricht, Maastricht, The Netherlands 3 Mitochondrial Research Group, University of Newcastle upon Tyne, Newcastle upon Tyne, UK 4 Department of IVF, Academic Hospital Maastricht, Maastricht, The Netherlands 5 Department of Neurology, Erasmus Medical Center Rotterdam, Rotterdam, Netherlands

6 To whom correspondence should be addressed at: Department of Genetics and Cell Biology, University of Maastricht, P.O. Box 616, 6200 MD Maastricht, The Netherlands. Tel: +31 (0)43 3881995; Fax: +31 (0)43 3884573; E-mail: bert.smeets{at}molcelb.unimaas.nl


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Little is known about the load of mutations and polymorphisms in the mitochondrial DNA (mtDNA) of human oocytes and the possible effect these mutations may have during life. To investigate this, we optimised at the single cell level the recently developed method to screen the entire mtDNA for mainly heteroplasmic mutations by denaturing high performance liquid chromatography analysis. This method is sensitive (~1% heteroplasmy detectable), specific and rapid. The entire mtDNA of 26 oocytes of 13 women was screened by this method. Ten different heteroplasmic mutations, of which only one was located in the D-loop and two were observed twice, were detected in seven oocytes with mutation loads ranging from < 5% to 50%. From eight women > 1 oocyte was received and in four of them heteroplasmic differences between oocytes of the same woman were observed. In one of these four, two homoplasmic D-loop variants were also detected. Additionally, four oocytes of a single woman were sequenced using the MitoChip® (which lacks the D-loop region), but all sequences were identical. It is concluded that heteroplasmic mtDNA mutations are common in oocytes and that, depending on the position and mutation load, they might increase the risk on developing OXPHOS disease early or later in life.

Key Words: DHPLC/MitoChip®/Mitochondrial DNA (mtDNA)/oocytes and bottleneck


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
A large number of mutations (>200) and polymorphisms have been reported for mitochondrial DNA (mtDNA) (Brandon et al., 2005). One of the reasons is that the mtDNA is located in the mitochondria near the OXPHOS system, which produces mutagenic reactive oxygen species (ROS) as part of electron transport to produce energy in the form of ATP (Kuchino et al., 1987). This high mutation rate in combination with a lack of good repair mechanisms and recombination and the exclusive maternal transmission of mtDNA would predict a decay of the mtDNA during evolution. This does not happen due to the ‘mtDNA bottleneck’, which is a restriction in the number of mtDNA molecules to be transmitted, followed by an amplification of these founder molecules in oocytes (Howell et al., 1992). The bottleneck occurs during early stages of oocyte development in order to maintain homoplasmic mtDNA and minimize heteroplasmy (Cummins, 1998, 2001). As this happens very early during development, the chance to preserve age-related mutations in the early oocyte is small, although the low number of mtDNA copies per mitochondria in early developmental stages of oocytes renders these oocytes vulnerable to mutational events at this stage (Keefe et al., 1995). As a result of the mtDNA bottleneck, a preferentially healthy mtDNA population is maintained in oocytes and offspring. Several reports have shown that this bottleneck is no absolute safeguard (Poulton, 1995; Degoul et al., 1997; Lutz et al., 2000). There have been a number of investigations on the load of mtDNA deletions in oocytes that failed to develop into metaphase II (MII) oocytes (Chen et al., 1995; Keefe et al., 1995; Brenner et al., 1998; Reynier et al., 1998; Barritt et al., 1999; Hsieh et al., 2002) and, on average, 50% of human oocytes contain mtDNA deletions, although usually in extremely low heteroplasmy percentages.

Little is known about the presence of point mutations in the mtDNA of human oocytes. This is a major concern as, at least for children with mtDNA mutations, maternal inheritance is the exception rather than the norm and many children carry de novo mutations in the mtDNA (Thorburn, 2004). Therefore, we screened the entire mtDNA of 26 oocytes for heteroplasmic mutations by denaturing high performance liquid chromatography (DHPLC) analysis (van Den Bosch et al., 2000) and, additionally, four oocytes of one woman for homoplasmic and, less sensitive than by DHPLC, heteroplasmic variants by the resequencing MitoChip® (Maitra et al., 2004). The presence and mutation load of point mutations in these oocytes might provide a clue to the chance of developing ‘spontaneous’ severe OXPHOS disease or age-related complications, owing to mtDNA defects. Furthermore, it may provide insight in the performance of the bottleneck.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Human oocytes
A total of 26 oocytes from 13 women were donated by consenting couples undergoing in vitro fertilisation or intracytoplasmic sperm injection because of male infertility problems, except for two women who had an obstruction of the fallopian tube. The oocytes used were apparently normal in morphological appearance, but immature in development, although several oocytes developed into (MII) oocytes prior to analysis. There was no enrichment for poor quality oocytes, in which an increase of mtDNA rearrangements has been previously reported (Barritt et al., 1999). Oocytes were collected anonymously and no additional maternal material could be obtained. From the 26 oocytes, 4 were germinal vesicles, 13 were in metaphase I and 9 were in the fully developed MII stage. Donated oocytes were washed three times in sterile MQ in plastic dishes, and then transferred to a 0.2 ml tube in 1–2 µl volume. The oocytes were used immediately or frozen at – 20°C. All pipetting was performed with a sterile, filtered mouth pipette.

Cell lysis
DNA was extracted from the oocytes using a proteinase K-based isolation method (Zhou et al., 1997). Briefly, oocytes were thawed at room temperature and 10 µl of the DNA extraction solution (50 mM Tris–HCl, pH 8.5, 1 mM EDTA and 0.5% Tween 20, containing 200 µg ml–1 proteinase K) was added. Samples were incubated at 55°C for 2 h, followed by 10 min incubation at 95°C to inactivate the proteinase K.

PCR amplification of the mtDNA in single cells
Two rounds of nested PCR were performed. In the first round, the entire mtDNA was amplified using three Expand Long PCR reactions (at positions I: 612-7165, II: 6642-12639 and III: 11909-742 using primers IF: gaaaatgtttagacgggctcac, IR: cgccgatgaatatgatagtgaa, IIF: tatcctaccaggcttcggaata, IIR: atgatggaccatgtaacgaaca, IIIF: aaccacgttctcctgatcaaat and IIIR: atcgtggtgatttagagggtga). The reactions were performed using the ExpandTM Long Template PCR System (Roche, Basel, Switzerland) containing 500 µM per dNTP (Amersham Pharmacia Biotech AB, Uppsala, Sweden, 25 mM each), 2 ng µl–1 of each primer, 5 µl 10 x PCR buffer II, 3 µl cell-lysate and 0.5 µl Expand Long polymerase (with proofreading capacity) in a 50 µl reaction volume. The reactions were carried out in a 9700 thermocycler (Applied Biosystems, Foster City, USA) as follows: 95°C for 3 min; 10 cycles of 93°C for 10 s, 60°C for 30 s and 68°C for 8 min; 20 cycles of 93°C for 10 s, 60°C for 30 s and 68°C for 8 min plus 20 s per elongation step and a final 7 min elongation at 68°C. In the second round, the entire mtDNA was amplified in 13 separate fragments (van Den Bosch et al., 2000), using 3 µl of the Expand Long PCR product in a reaction volume of 50 µl containing 0.8 µM per dNTP, 0.4 µM of each primer, 1.5 mM MgSO4, 5 µl Optimase® polymerase buffer and 2.5 U Optimase® polymerase (Transgenomic, Omaha, USA). The reactions were carried out in a 9700 thermocycler (Perkin-Elmer) according to the Optimase ProtocolWriterTM as either a normal step PCR procedure or as a touchdown PCR if the melting temperature of both primers was separated by > 3°. Following PCR amplification, the DNA samples were denatured at 95°C, reannealed at 65°C and cooled to 4°C to form heteroduplexes. If necessary, smaller PCR fragments were amplified by using 1 µl of the Expand Long PCR product in a total reaction volume of 50 µl containing 0.8 µM per dNTP, 0.4 µM of each primer, 1.5 mM MgSo4, 5 µl Optimase® polymerase buffer and 2.5 U Optimase® polymerase (Transgenomic, Omaha, USA).

DHPLC analysis of the mtDNA and fragment collection
Amplified second round products were cleaved with restriction enzymes to obtain smaller fragments of 90–560 basepairs in length as described before (van den Bosch et al., 2000). After purification with the QIAquickTM PCR purification kit (Qiagen, GmbH, Hilden, Germany), DHPLC analysis was performed on the Transgenomic WAVE® system. Low percentage heteroduplex peaks were reanalysed on the WAVE and the deviant peaks were collected using the FCX-200 fragment collector (Transgenomic). Fragment collection was performed in a two-step procedure. In the first DHPLC run, the time window for the elution of the peaks of interest was determined. During a second injection, DHPLC fragments were collected during the previously defined time interval.

Sequence analysis of PCR fragments
Sequencing reactions were performed in a total volume of 20 µl, using 2 µl Big Dye termination solution according to the protocols of the manufacturer (Applied Biosystems) and 50 ng forward or reverse primer, using an ABI Prism 3100 DNA automatic sequencer (Applied Biosystems) and ABI analysis software version 3.1.

Resequencing the mtDNA in single cells with the MitoChip®
The three initial long-range PCR fragments were re-amplified—PCR products were purified from residual primers and nucleotides using QIAQuick PCR cleanup kit and resuspended in 30 µl of EB buffer (QIAGEN). The yield of each PCR product after purification was determined using a nanodrop ND-1000 spectrophotometer and the equimolar amounts of the three fragments were pooled. After fragmentation and labelling, the products were hybridized on a pre-hybridized MitoChip® as described in the Affymetrix customSeqTM Resequencing protocol (Affymetrix, Santa Clara, USA). Following hybridization, the chips were washed and stained on the GeneChip fluidics station 400 (Affymetrix) using the pre-programmed CustumSeq Resequencing wash and stain protocol (DNA ARRAY-WS2). The Mitochips were scanned using the Affymetrix GeneChip scanner 3000 creating .CEL files for subsequent batch analysis. The Affymetrix GeneChip DNA Analysis Software version 3.0.1.3 [EC] beta was used for the analysis of the CEL files.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The entire mtDNA of 26 oocytes was screened by DHPLC analysis. Although these are single cells, it does not mean that this is a single template analysis. Oocytes contain about 100 000 mtDNA molecules, and the number of templates is comparable to 50 000 cells for a nuclear gene. Three types of alterations were detected by DHPLC analysis: heteroduplex peaks, indicating heteroplasmic mutations, shifts of the entire homoduplex peak and the loss or gain of a restriction site. The last two alterations pointed towards homoplasmic changes and were only studied when differing between oocytes of a single woman. A total of 12 heteroduplex peaks and 2 homoduplex shifts (Tables I and II) were identified and characterized by sequence analysis. All changes identified were A to G or T to C changes. For six samples, heteroplasmic peak fraction collection was required (Table I). Heteroplasmy levels were determined using restriction fragment analysis (oocyte 9) or estimated from the DHPLC and sequencing peak surfaces. In case fragment collection was required, the heteroplasmy level was estimated to be < 5%, based on the detection level of DHPLC analysis.


View this table:
[in this window]
[in a new window]

 
Table I. Heteroplasmic mtDNA changes in 26 oocytes

 

View this table:
[in this window]
[in a new window]

 
Table II. Differences in the mtDNA of oocytes obtained from one woman

 
Two homoplasmic changes were observed in the non-coding D-loop region between two oocytes of the same woman. As DHPLC analysis has a limited sensitivity to detect homoplasmic alterations, we do not know how many homoplasmic mutations might have been missed, not only in the D-loop, but especially in the remaining coding part of the mtDNA. Therefore, we used the MitoChip®, which contains the entire coding part of mtDNA but unfortunately not of the D-loop region, to analyse the four oocytes of woman 4. We did not detect any additional homoplasmic or heteroplasmic differences between the oocytes of this woman. The detection level of the MitoChip® appears to be mutation-dependent and varies from 5 to 30% heteroplasmy in our hands (van Eijsden et al., 2006). This is less sensitive than reported by others (Jakupciak et al., 2005).


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
DHPLC analysis has been frequently reported for the detection of mtDNA mutations (van den Bosch et al., 2000; Liu et al., 2002; Conley et al., 2003; Biggin et al., 2005), and we adapted the method at the single cell level. DHPLC analysis is highly sensitive, with a detection level of < 5% and probably 1% heteroplasmy. Several different mutations were identified in oocytes with heteroplasmy percentages varying from < 5 to 50%. It is unlikely that PCR artefacts or nuclear pseudogenes can explain the low level alterations, because the DNA polymerases have a proofreading capacity and the number of mtDNA templates is higher (100 000 mtDNA molecules per oocyte) compared with the two copies of a nuclear template. On the basis of the number of templates and PCR cycles and length of fragments, the maximum level for PCR-induced mutation could be between 0.05 and 0.1% for a specific mutation, which is below the detection limit of DHPLC analysis. The possibility of a contamination has also been excluded by the use of negative controls, with no DNA in each step of the procedure. All changes identified were A to G or T to C changes. Most changes were known variants, except for two, m.6408A > G and m.8542T > C, which have not been described before. Two mutations, m.6776T > C and m.6791A > G, were identified twice, which indicates that hot spots may exist, although the majority of the heteroplasmic mutations are scattered across the mtDNA. Earlier observations using bioinformatics and perceived mutations indicated a prominent instability of the guanine nucleotide in the mitochondrial genome. This instability was, however, most pronounced at the 3' and/or 5' end of the protein coding genes (Tanaka and Ozawa, 1994; Samuels et al., 2003). In contrast, the variants in the oocytes are predominant in the middle part of the coding genes and do not preferentially involve guanine residues (Samuels et al., 2003). Three of the observed changes were located in the D-loop, which is in line with the literature, which predicts that many point mutations may be contained in the mitochondrial control region (Chinnery et al., 1999; Clayton, 2000; Fernandez-Silva et al., 2003). This hypervariability of the D-loop has been observed in other tissues as well especially in relation to ageing and cancer (Cormio et al., 2005), but a bias exists, as often only the D-loop is studied and mutations in other areas can be missed (Lee et al., 2005; Lievre et al., 2005). Recent data suggest that in cancer too, mutations are distributed among the entire mtDNA, including the D-loop (Maitra et al., 2004; Jakupciak et al., 2005). So despite a preference for the D-loop region, mutations in the mtDNA can arise at any location in the oocytes.

The heteroplasmy level of point mutations in the coding region of mtDNA in oocytes ranged from < 5 to ~50%. As the maternal sequence is unknown, the mutation load is given for the nucleotide, which is most likely the mutated one, although this can be ambiguous. In the case of multiple oocytes of a single woman, the sequence that was shared by most of the oocytes was considered as the maternal sequence. Although we did not detect an evidently pathogenic mutation, it can be expected that pathogenic mutations will not be uncommon, as mutations are scattered throughout the mtDNA. On average 20 (between 15–30 locations) positions in a tRNA molecule and 25% of the amino acids in the proteins are evolutionary conserved, indicating that as an estimate ~5% of the mutations in the mtDNA can alter a conserved nucleotide and thus potentially be pathogenic. We found heteroplasmic changes in 26.9% of the oocytes, which means that probably ~1% of the oocytes will carry a pathogenic point mutation. We did not detect mutation levels > 50% (although for oocyte 17 we cannot be sure, because we could not deduce the maternal reference sequence from other oocytes), which is under the threshold level for common point mutations such as m.8344A > G, m.8993T > G, m.8993T > C and m.9176T > C [thresholds of respectively > 70%, > 60%, > 80% and > 90% (Chinnery et al., 1997; White et al., 1999; Jacobs et al., 2005)], although other point mutations such as the m.3243A > G mutation, can lead to clinical symptoms at heteroplasmy levels < 30% (Thorburn and Dahl, 2001). Under the assumption that mutation levels > 50% may exist and have not been detected due to the small sample size, or that mutation levels in cells might increase in the first cell divisions, we predict that ~1% of the oocytes will have a mutation level reaching above the threshold of expression. Combined with the calculated number of pathogenic mutations in oocytes, this would account for about 1:10 000 de novo cases of mtDNA disease, which is in line with the observed prevalence of OXPHOs disease and the high frequency of de novo mutations (Chinnery and Turnbull, 2001; Thorburn, 2004) and which is supported by case reports on de novo mutations in severely affected patients (De Coo et al., 1996; Degoul et al., 1997; Maassen et al., 2002; Thorburn, 2004).

In our study, no deletions were detected after analysis of the first round PCR products, but we only systematically analysed the shortest fragment, as the other two fragments were not visible on agarose gel. Also, the common deletion could not be detected by the nature of our PCR-assay. In previous reports, mtDNA rearrangements have been observed in over 50% of the oocytes analysed, especially in those at the germinal vesicle stage (Chen et al., 1995; Brenner et al., 1998; Barritt et al., 1999; Hsieh et al., 2002). Differences between these studies and ours were the number of PCR cycles [at least 65 (Chen et al., 1995; Brenner et al., 1998; Barritt et al., 1999) compared with our first round of 30 cycles] and the size of the mtDNA fragment tested, which could explain why we did not detect these rearrangements in the mtDNA. In general the mutation levels of the point mutations are low and mutations can be lost during further cell divisions. This is also the case for the heteroplasmy level of the de novo rearrangements, which was about 0.1% of the mtDNA (Chen et al., 1995). Low-level mutations can, however, ultimately have phenotypic consequences as they can get fixed in some occasions by random genetic drift. This has been observed in rapidly dividing colonic crypt cells (Taylor et al., 2003) and cancer cells (Carew and Huang, 2002). This means that a low level of an mtDNA mutation in the oocyte may accumulate during life in specific tissues, such as cytochrome b mutations in muscle (Andreu et al., 1999). A deterioration of the OXPHOS system during life due to this accumulation may be a key factor in many age-related diseases (Cottrell and Turnbull, 2000; Wei and Lee, 2002).

The bottleneck preserves a homoplasmic mtDNA content early during oocyte formation. The lowest number of mitochondria (<10) is found in the early primordial germ cells (PGCs) of 3-week old embryos (Jansen and de Boer, 1998), allowing most individuals to start with an entirely homoplasmic ‘clean’ mtDNA (Cummins, 1998, 2001). As this process takes place early, the chance to preserve age-related mutations in the early oocyte is small. On the basis of our data, it appears that this system works very well. The bottleneck is calculated to be between 1 and 30 mtDNA molecules (Bendall et al., 1996; Poulton et al., 1998), indicating that an mtDNA mutation leaking through with replication being proportional would lead to a heteroplasmy percentage between 3.5 and 100%. Two homoplasmic differences were detected between two oocytes of a single woman. A single mtDNA molecule as a segregating unit can explain this, although we cannot be sure as we could not analyse the maternal mtDNA. It does, however, indicate that the segregation can happen very fast, as has been shown for Holstein cattle (Koehler et al., 1991) and pathogenic mutations in humans (De Coo et al., 1996; Degoul et al., 1997). Five of our mutations had a heteroplasmy percentage of ~15–50%, and these mutations could have been leaking through the bottleneck or have originated very early during oocyte development. At that stage the amount of mitochondria and mtDNA molecules in the oocyte is low, usually only one mtDNA molecule per mitochondrion (Michaels et al., 1982; Chen et al., 1995) and, if a mutation occurs, it affects a higher proportion of the mtDNA molecules. Since none of the mutations was observed in other oocytes of the same woman, this indicates that the mutations probably originated early during oocyte development, although the number of oocytes analysed in total and per woman is still rather small. The levels of other mutations were very low (<5%) and are, therefore, thought to have occurred de novo after the bottleneck and the earliest developmental stages of the oocyte and after migration of the PGCs to the ovary. If the mutated mtDNA does not specifically increase, then they must have occurred before the embryo reached the fetal stages, because by then the number of mitochondria in the oocyte is > 1000 and mutations would not be detected anymore as single heteroplasmic peaks by DHPLC analysis.

Seven oocytes carried one or more point mutations in the mtDNA. Five of these contained only a single heteroplasmic mutation, whereas one oocyte contained two and the last one four heteroplasmic mutations. In case an oocyte carries more than one mutation, the levels are generally low and can for this reason be considered as early embryonic, somatic mutations. Because of these small numbers, it is unclear if some oocytes are more susceptible for mutational events than others or that it is just a chance event. Several reasons can be considered for the existence of multiple mtDNA mutations in one oocyte. The first is possible environmental damage by, for example ROS, radiation or chemical substances. Another aspect that could play a role is defects in genes associated with mtDNA replication and repair. Recently it was shown that the mtDNA in mice can be subject to several forms of DNA repair (Larsen et al., 2005). If this is also the case in human cells, problems arising in one of these repair mechanisms could also influence the occurrence of mutations in oocytes. It is known from human patients and mice studies that a dysfunctional polymerase gamma leads to deletions and point mutations in the mtDNA (Trifunovic et al., 2004). However, if there were genetic problems in the mtDNA repair mechanism, one would expect to observe this susceptibility in more oocytes from the same woman, although this may not be that obvious as repair may depend on oocyte and embryo quality and this may differ in the same cohort.

From our study, it can be concluded that the mtDNA bottleneck is in general an effective mechanism in preserving a homoplasmic state of the mtDNA. However, we observed 14 mutations in 8 oocytes (total 26), 10 of which were present in the coding part of the mtDNA. The distribution of these mutations appears to be random and as four of these mutations have substantial heteroplasmy levels (ranging form 15 to 50%), we hypothesize that these mutations, presumably occurring very early during oocyte development, may contribute to de novo mtDNA disease, which is a frequent cause of OXPHOS disease in children (Thorburn, 2004).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Andreu AL, Hanna MG, Reichmann H, Bruno C, Penn AS, Tanji K, Pallotti F, Iwata S, Bonilla E, Lach B, et al. (1999) Exercise intolerance due to mutations in the cytochrome b gene of mitochondrial DNA. N Engl J Med 341:1037–1044.[Abstract/Free Full Text]

Barritt JA, Brenner CA, Cohen J, Matt DW. (1999) Mitochondrial DNA rearrangements in human oocytes and embryos. Mol Hum Reprod 5:927–933.[Abstract/Free Full Text]

Bendall KE, Macaulay VA, Baker JR, Sykes BC. (1996) Heteroplasmic point mutations in the human mtDNA control region. Am J Hum Genet 59:1276–1287.[Web of Science][Medline]

Biggin A, Henke R, Bennetts B, Thorburn DR, Christodoulou J. (2005) Mutation screening of the mitochondrial genome using denaturing high-performance liquid chromatography. Mol Genet Metab 84:61–74.[CrossRef][Web of Science][Medline]

Brandon MC, Lott MT, Nguyen KC, Spolim S, Navathe SB, Baldi P, Wallace DC. (2005) MITOMAP: a human mitochondrial genome database—2004 update. Nucl Acids Res 33:Database IssueD611–D613.[Abstract/Free Full Text]

Brenner CA, Wolny YM, Barritt JA, Matt DW, Munne S, Cohen J. (1998) Mitochondrial DNA deletion in human oocytes and embryos. Mol Hum Reprod 4:887–892.[Abstract/Free Full Text]

Carew JS and Huang P. (2002) Mitochondrial defects in cancer. Mol Cancer 1:9.[CrossRef][Medline]

Chen X, Prosser R, Simonetti S, Sadlock J, Jagiello G, Schon EA. (1995) Rearranged mitochondrial genomes are present in human oocytes. Am J Hum Genet 57:239–247.[Web of Science][Medline]

Chinnery PF, Brown DT, Andrews RM, Singh-Kler R, Riordan-Eva P, Lindley J, Applegarth DA, Turnbull DM, Howell N. (2001) The mitochondrial ND6 gene is a hot spot for mutations that cause Leber's hereditary optic neuropathy. Brain 124:209–218.[Abstract/Free Full Text]

Chinnery PF, Howell N, Andrews RM, Turnbull DM. (1999) Mitochondrial DNA analysis: polymorphisms and pathogenicity. J Med Genet 36:505–510.[Abstract/Free Full Text]

Chinnery PF, Howell N, Lightowlers RN, Turnbull DM. (1997) Molecular pathology of MELAS and MERRF. The relationship between mutation load and clinical phenotypes. Brain 120:Pt 101713–1721.[Abstract/Free Full Text]

Chinnery PF and Turnbull DM. (2001) Epidemiology and treatment of mitochondrial disorders. Am J Med Genet 106:94–101.[CrossRef][Web of Science][Medline]

Clayton DA. (2000) Transcription and replication of mitochondrial DNA. Hum Reprod 15:Suppl 2, 11–17.[Abstract/Free Full Text]

Conley YP, Brockway H, Beatty M, Kerr ME. (2003) Qualitative and quantitative detection of mitochondrial heteroplasmy in cerebrospinal fluid using denaturing high-performance liquid chromatography. Brain Res Brain Res Protoc 12:99–103.[CrossRef][Medline]

Cormio A, Milella F, Vecchiet J, Felzani G, Gadaleta MN, Cantatore P. (2005) Mitochondrial DNA mutations in RRF of healthy subjects of different age. Neurobiol Aging 26:655–664.[CrossRef][Web of Science][Medline]

Cottrell DA and Turnbull DM. (2000) Mitochondria and ageing. Curr Opin Clin Nutr Metab Care 3:473–478.[CrossRef][Medline]

Cummins J. (1998) Mitochondrial DNA in mammalian reproduction. Rev Reprod 3:172–182.[Abstract]

Cummins JM. (2001) Mitochondria: potential roles in embryogenesis and nucleocytoplasmic transfer. Hum Reprod Update 7:217–228.[Abstract/Free Full Text]

De Coo IF, Smeets HJ, Gabreels FJ, Arts N, van Oost BA. (1996) Isolated case of mental retardation and ataxia due to a de novo mitochondrial T8993G mutation. Am J Hum Genet 58:636–638.[Web of Science][Medline]

Degoul F, Francois D, Diry M, Ponsot G, Desguerre I, Heron B, Marsac C, Moutard ML. (1997) A near homoplasmic T8993G mtDNA mutation in a patient with atypic Leigh syndrome not present in the mother's tissues. J Inherit Metab Dis 20:49–53.[CrossRef][Web of Science][Medline]

Fernandez-Silva P, Enriquez JA, Montoya J. (2003) Replication and transcription of mammalian mitochondrial DNA. Exp Physiol 88:41–56.[Abstract]

Herrnstadt C, Elson JL, Fahy E, Preston G, Turnbull DM, Anderson C, Ghosh SS, Olefsky JM, Beal MF, Davis RE, et al. (2002) Reduced-median-network analysis of complete mitochondrial DNA coding-region sequences for the major African, Asian, and European haplogroups. Am J Hum Genet 70:1152–1171.[CrossRef][Web of Science][Medline]

Horai S, Kondo R, Nakagawa-Hattori Y, Hayashi S, Sonoda S, Tajima K. (1993) Peopling of the Americas, founded by four major lineages of mitochondrial DNA. Mol Biol Evol 10:23–47.[Abstract]

Howell N, Halvorson S, Kubacka I, McCullough DA, Bindoff LA, Turnbull DM. (1992) Mitochondrial gene segregation in mammals: is the bottleneck always narrow? Hum Genet 90:117–120.[CrossRef][Web of Science][Medline]

Hsieh RH, Tsai NM, Au HK, Chang SJ, Wei YH, Tzeng CR. (2002) Multiple rearrangements of mitochondrial DNA in unfertilized human oocytes. Fertil Steril 77:1012–1017.[CrossRef][Web of Science][Medline]

Jacobs LJ, de Coo IF., Nijland JG, Galjaard RJ, Los FJ, Schoonderwoerd K, Niermeijer MF, Geraedts JP, Scholte HR, Smeets HJ. (2005) Transmission and prenatal diagnosis of the T9176C mitochondrial DNA mutation. Mol Hum Reprod. 11:223–228.[Abstract/Free Full Text]

Jakupciak JP, Wang W, Markowitz ME, Ally D, Coble M, Srivastava S, Maitra A, Barker PE, Sidransky D, O'Connell CD. (2005) Mitochondrial DNA as a cancer biomarker. J Mol Diagn 7:258–267.[Abstract/Free Full Text]

Jansen RP and de Boer K. (1998) The bottleneck: mitochondrial imperatives in oogenesis and ovarian follicular fate. Mol Cell Endocrinol 145:81–88.[CrossRef][Web of Science][Medline]

Keefe DL, Niven-Fairchild T, Powell S, Buradagunta S. (1995) Mitochondrial deoxyribonucleic acid deletions in oocytes and reproductive aging in women. Fertil Steril 64:577–583.[Web of Science][Medline]

Koehler CM, Lindberg GL, Brown DR, Beitz DC, Freeman AE, Mayfield JE, Myers AM. (1991) Replacement of bovine mitochondrial DNA by a sequence variant within one generation. Genetics 129:247–255.[Abstract]

Kuchino Y, Mori F, Kasai H, Inoue H, Iwai S, Miura K, Ohtsuka E, Nishimura S. (1987) Misreading of DNA templates containing 8-hydroxydeoxyguanosine at the modified base and at adjacent residues. Nature 327:77–79.[CrossRef][Medline]

Larsen NB, Rasmussen M, Rasmussen LJ. (2005) Nuclear and mitochondrial DNA repair: similar pathways? Mitochondrion 5:89–108.[CrossRef][Web of Science][Medline]

Lee HC, Yin PH, Lin JC, Wu CC, Chen CY, Wu CW, Chi CW, Tam TN, Wei YH. (2005) Mitochondrial genome instability and mtDNA depletion in human cancers. Ann NY Acad Sci 1042:109–122.[CrossRef][Web of Science][Medline]

Lievre A, Chapusot C, Bouvier AM, Zinzindohoue F, Piard F, Roignot P, Arnould L, Beaune P, Faivre J, Laurent-Puig P. (2005) Clinical value of mitochondrial mutations in colorectal cancer. J Clin Oncol 23:3517–3525.[Abstract/Free Full Text]

Liu MR, Pan KF, Li ZF, Wang Y, Deng DJ, Zhang L, Lu YY. (2002) Rapid screening mitochondrial DNA mutation by using denaturing high-performance liquid chromatography. World J Gastroenterol 8:426–430.[Web of Science][Medline]

Lutz S, Weisser HJ, Heizmann J, Pollak S. (2000) Mitochondrial heteroplasmy among maternally related individuals. Int J Legal Med 113:155–161.[CrossRef][Web of Science][Medline]

Maassen JA, Biberoglu S, ‘t Hart LM, Bakker E, de Knijff P. (2002) A case of a de novo A3243G mutation in mitochondrial DNA in a patient with diabetes and deafness. Arch Physiol Biochem 110:186–188.[CrossRef][Medline]

Maitra A, Cohen Y, Gillespie SE, Mambo E, Fukushima N, Hoque MO, Shah N, Goggins M, Califano J, Sidransky D, et al. (2004) The Human MitoChip: a high-throughput sequencing microarray for mitochondrial mutation detection. Genome Res 14:812–819.[Abstract/Free Full Text]

Marzuki S, Noer AS, Lertrit P, Thyagarajan D, Kapsa R, Utthanaphol P, Byrne E. (1991) Normal variants of human mitochondrial DNA and translation products: the building of a reference data base. Hum Genet 88:139–145.[CrossRef][Web of Science][Medline]

Michaels GS, Hauswirth WW, Laipis PJ. (1982) Mitochondrial DNA copy number in bovine oocytes and somatic cells. Dev Biol 94:246–251.[CrossRef][Web of Science][Medline]

Poulton J. (1995) Transmission of mtDNA: cracks in the bottleneck. Am J Hum Genet 57:224–226.[Web of Science][Medline]

Poulton J, Macaulay V, Marchington DR. (1998) Mitochondrial genetics '98 is the bottleneck cracked? Am J Hum Genet 62:752–757.[CrossRef][Web of Science][Medline]

Povalko N, Zakharova E, Rudenskaia G, Akita Y, Hirata K, Toyojiro M, Koga Y. (2005) A new sequence variant in mitochondrial DNA associated with high penetrance of Russian Leber hereditary optic neuropathy. Mitochondrion 5:194–199.[CrossRef][Web of Science][Medline]

Reynier P, Chretien MF, Savagner F, Larcher G, Rohmer V, Barriere P, Malthiery Y. (1998) Long PCR analysis of human gamete mtDNA suggests defective mitochondrial maintenance in spermatozoa and supports the bottleneck theory for oocytes. Biochem Biophys Res Commun 252:373–377.[CrossRef][Web of Science][Medline]

Samuels DC, Boys RJ, Henderson DA, Chinnery PF. (2003) A compositional segmentation of the human mitochondrial genome is related to heterogeneities in the guanine mutation rate. Nucl Acids Res 31:6043–6052.[Abstract/Free Full Text]

Tanaka M and Ozawa T. (1994) Strand asymmetry in human mitochondrial DNA mutations. Genomics 22:327–335.[CrossRef][Web of Science][Medline]

Taylor RW, Barron MJ, Borthwick GM, Gospel A, Chinnery PF, Samuels DC, Taylor GA, Plusa SM, Needham SJ, Greaves LC, et al. (2003) Mitochondrial DNA mutations in human colonic crypt stem cells. J Clin Invest 112:1351–1360.[CrossRef][Web of Science][Medline]

Thorburn DR. (2004) Mitochondrial disorders: prevalence, myths and advances. J Inherit Metab Dis 27:349–362.[CrossRef][Web of Science][Medline]

Thorburn DR and Dahl HH. (2001) Mitochondrial disorders: genetics, counseling, prenatal diagnosis and reproductive options. Am J Med Genet 106:102–114.[CrossRef][Web of Science][Medline]

Trifunovic A, Wredenberg A, Falkenberg M, Spelbrink JN, Rovio AT, Bruder CE, Bohlooly YM, Gidlof S, Oldfors A, Wibom R, et al. (2004) Premature ageing in mice expressing defective mitochondrial DNA polymerase. Nature 429:417–423.[CrossRef][Medline]

van den Bosch BJ, de Coo RF, Scholte HR, Nijland JG, van Den Bogaard R, de Visser M, de Die-Smulders CE, Smeets HJ. (2000) Mutation analysis of the entire mitochondrial genome using denaturing high-performance liquid chromatography. Nucl Acids Res 28:E89.

van Eijsden RG., Gerards M, Eijssen LM, Hendrickx AT, Jongbloed RJ, Wokke JH, Hintzen RQ, Rubio-Gozalbo ME, De Coo IF, Briem E, et al. (2006) Chip-based mtDNA mutation screening enables fast and reliable genetic diagnosis of OXPHOS patients. Genet Med 8:620–627.[Web of Science][Medline]

Wei YH and Lee HC. (2002) Oxidative stress, mitochondrial DNA mutation, and impairment of antioxidant enzymes in aging. Exp Biol Med (Maywood) 227:671–682.[Abstract/Free Full Text]

White SL, Collins VR, Wolfe R, Cleary MA, Shanske S, DiMauro S, Dahl HH, Thorburn DR. (1999) Genetic counseling and prenatal diagnosis for the mitochondrial DNA mutations at nucleotide 8993. Am J Hum Genet 65:474–482.[CrossRef][Web of Science][Medline]

Zhou L, Chomyn A, Attardi G, Miller CA. (1997) Myoclonic epilepsy and ragged red fibers (MERRF) syndrome: selective vulnerability of CNS neurons does not correlate with the level of mitochondrial tRNAlys mutation in individual neuronal isolates. J Neurosci 17:7746–7753.[Abstract/Free Full Text]

Submitted on October 8, 2006; resubmitted on November 24, 2006; accepted on November 30, 2006.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
BMJHome page
J. Poulton, S. Kennedy, P. Oakeshott, and D. Wells
Preventing transmission of maternally inherited mitochondrial DNA diseases
BMJ, January 30, 2009; 338(jan30_1): b94 - b94.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Advance Access manuscript (PDF) Freely available
Right arrow All Versions of this Article:
13/3/149    most recent
gal112v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Jacobs, L.
Right arrow Articles by Smeets, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jacobs, L.
Right arrow Articles by Smeets, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?